Unlock instant, AI-driven research and patent intelligence for your innovation.

Short-chain dehydrogenase mutants and uses thereof

A short-chain dehydrogenase, mutant technology, applied in application, oxidoreductase, introduction of foreign genetic material using vectors, etc., can solve the problems of pollution, poor selectivity, extreme operating conditions, etc.

Active Publication Date: 2021-07-30
SHENYANG PHARMA UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Above-mentioned three kinds of methods are all applied in the commercial synthesis chiral alcohol, but they have more disadvantages: as using a large amount of expensive reagents, causing a large amount of pollution, using extreme operating conditions etc., this just needs to develop a kind of A more economical and environmentally friendly synthesis method for chiral alcohols
[0005] At present, the main problem restricting the application of ketoreductase is that the natural ketoreductase has certain defects, such as low activity, poor selectivity, opposite to expectations, etc., so that its application in production practice is limited to a certain extent. Successful modification and It is a research hotspot to modify ketoreductase to have better properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Short-chain dehydrogenase mutants and uses thereof
  • Short-chain dehydrogenase mutants and uses thereof
  • Short-chain dehydrogenase mutants and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Extraction of Bacillus megaterium genomic DNA and cloning of wild-type BmSDR5 gene

[0045] After culturing Bacillus megaterium with LB liquid overnight, the fermentation broth was centrifuged in a 1mL centrifuge tube at 3000r / min for 5min, and the supernatant was discarded to collect the cells, which could be repeated several times to obtain a sufficient amount of cells; b) The cells were lysed with a sufficient amount of DNA Then add 200 μL of phenol: chloroform: isoamyl alcohol, and tightly cover the tube cap to prevent the phenol from leaking out during vortexing; c) vortex at high speed for 3 min; d) centrifuge at 12000 r / min for 5 min, and the supernatant ( About 200 μL) transferred to a new centrifuge tube; e) After adding 700 μL of pre-cooled absolute ethanol to the supernatant, store it in anhydrous at -20 ° C for 1 hour, centrifuge at 12000 r / min for 15 minutes to precipitate DNA, pour off the ethanol, and use 800 μL of ethanol for precipitation , su...

Embodiment 2

[0046] Embodiment 2 polymerase chain reaction (PCR)

[0047] Using the extracted Bacillus megaterium genomic DNA as a template for PCR reaction, the reaction system is as follows:

[0048]

[0049] Amplification program: 94°C: 10Min, (94°C: 30s, 45°C: 30s, 72°C: 30s) 35 cycles, 72°C, 10min.

[0050] Primer 1: BmSDR5-BamHI-F: CG GGATCC GATGTTTGAAGAAAAAGTAGGGAT;

[0051] Primer 2: BmSDR5-XhoI-R: CCG CTCGAG CTCAAACCTAAACCCAATCC;

[0052] Restriction endonuclease cut sites are underlined;

[0053] The DNA fragments amplified by PCR were purified using a gel recovery kit. E.coli DH5α containing the pET-22b plasmid was cultured overnight in LB liquid medium at 37°C and 220r / min, and the plasmid was extracted using the reference TIANprep Mini Plasmid Kit. The target fragment and the plasmid pET-22 are limited to double enzyme digestion, and the enzyme digestion system is as follows:

[0054]

Embodiment 3

[0055] Example 3 Preparation and transformation of E.coli DH5α and BL21 competent cells

[0056] a) Take 0.4mL from the seed culture medium and inoculate it into 20mL LB liquid medium for 3h; b) 3000r / min, 5min to enrich 2mL of bacteria in 1.5mLEP tube twice, discard the supernatant; c) add 100 Discard the ice-cold TSS solution, resuspend the cells, and ice-bath for 30 minutes; d) Add 20 μL of connection solution (empty plasmid pPICZαA enzyme-digested fragment, target fragment enzyme-digested fragment, and connection solution) and gently swirl to mix well, and ice-bath for 30 minutes; e) Heat shock at 42°C for 60s, ice bath for 2min, and add 600μL LB liquid medium. Cultivate at 37°C and shake at 150r / min for 1h; f) Take 150μL and spread them on ampicillin-resistant LB plates.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the field of biotechnology, and relates to short-chain dehydrogenase mutants and applications thereof. Such mutants are obtained through mutation from wild-type short-chain dehydrogenases, and specifically relate to short-chain dehydrogenase mutants and The preparation method thereof and the method for preparing optically active phenethyl alcohol derivatives by utilizing short-chain dehydrogenase mutants through the reduction of acetophenone derivative compounds.

Description

Technical field: [0001] The present invention relates to the field of biotechnology, and relates to short-chain dehydrogenase mutants and applications thereof. Such mutants are obtained through mutation from wild-type short-chain dehydrogenases, and specifically relate to short-chain dehydrogenase mutants and The preparation method thereof and the method for preparing optically active phenethyl alcohol derivatives by using short-chain dehydrogenase mutants to catalyze the reduction of acetophenone derivative compounds. Background technique [0002] Chiral alcohol is a universal synthetic building block for many active medicinal ingredients. The traditional methods for synthesizing chiral alcohol include chiral pool method, asymmetric synthesis method and resolution method. Above-mentioned three kinds of methods are all applied in the commercial synthesis chiral alcohol, but they have more disadvantages: as using a large amount of expensive reagents, causing a large amount of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/22
CPCC12N9/0006C12N15/70C12P7/22
Inventor 游松秦斌秦凤玉张文鹤刘亚林祝天慧郭继阳张飞霆
Owner SHENYANG PHARMA UNIVERSITY