Method of breeding mung bean sterile mutant based on CRISPR/Cas9 gene editing technology and special gRNA

A gene editing and mutant technology, applied in the field of molecular breeding, genetic engineering, and molecular biology, can solve the problems of lack of male sterile lines in mung bean, and achieve the effect of simple method and high success rate

Inactive Publication Date: 2018-10-12
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF2 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, mung bean currently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of breeding mung bean sterile mutant based on CRISPR/Cas9 gene editing technology and special gRNA
  • Method of breeding mung bean sterile mutant based on CRISPR/Cas9 gene editing technology and special gRNA

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0023] Example 1 Design of gRNA for editing VrPUB4

[0024] VrPUB4 (LOC106752492) encodes a protein with U-Box structure.

[0025] According to the principle of CRISPR / Cas9 gene editing, the 20nt before the protospacer adjacent motif (PAM, or "NGG", where "N" is any nucleotide) of the sequence of the gene VrPUB4 shown in SEQ ID NO.1 is gRNA sequence. If the first nucleotide at the 5'end of the gRNA is not guanine (G), add a G at the 5'end, and the gRNA is 21 nt long. All gRNAs designed in the gene VrPUB4 are shown in Table 1. The gRNA sequence should be on the exon, not too close to the ATG initiator, and should be in the middle part of the entire gene. Blast alignment of gRNA in the mung bean gene green database (http: / / plantgenomics.snu.ac.kr / mediawiki-1.21.3 / index.php / Main_Page) to confirm that the target sequence is unique in the mung bean genome.

[0026] Table 1gRNA sequence

[0027]

Example Embodiment

[0028] Example 2 Construction of CRISPR vector for editing VrPUB4

[0029] The framework of editing the CRISPR vector of VrPUB4 is pYAO:hSpCas9(Yan L,Wei S,Wu Y, etal.High-efficiency genome editing in Arabidopsis using YAO promoter-drivenCRISPR / Cas9system[J].Molecular plant,2015,8(12) :1820-1823.), the construction method of the CRISPR vector used to edit VrPUB4 is as follows:

[0030] Synthesis of positive and negative oligonucleotide chains 1) 5'-ATTG[20N or 21N]-3' and 2) 5'-AAAC[20n or 21n]-3'. Wherein "20N or 21N" is the gRNA sequence shown in Table 1, and 20n or 21n is the reverse complementary sequence of the gRNA shown in Table 1. For example, the reverse complementary sequence of GGACCGGCACCTATGATGATAGG is CCTATCATCATAGGTGCCGGTCC. The gRNA specifically used in this example and example 3 is the first sequence TTCGCCTTGTCTCTAACAATCGG in Table 1.

[0031] Anneal the two oligonucleotide strands 1) and 2). The protocol is: a. Dissolve the oligonucleotide strand in ultrapure wat...

Example Embodiment

[0038] Example 3 Transformation of CRISPR plasmids into mung bean plants

[0039] Refer to Zhao et al. (Zhao X, Meng Z, Wang Y, et al. Pollen magnetofection for genetic modification with magnetic nanoparticles as gene carriers[J].Natureplants, 2017:1.), using magnetic nanocarriers to mediate pYAO:hSpCas9 -target-sgRNA plasmid transforms mung bean plants. The plasmid of MNP (PolyMag1000, purchased from Chemicell) was diluted to 1 μg / μl with ultrapure water, mixed at 1:4 and incubated at room temperature for 30 minutes to form a MNP-plasmid complex. The MNP-plasmid compound was added to 1ml pollen medium (each 100ml contains 15g sucrose, 0.03g Ca(NO 3 ) 2 ·4H 2 O, 0.01g H 3 BO 3 ) In.

[0040] In the morning, 100 mg of pollen was collected from the mung bean flower organs and placed in a petri dish, and the MNP-plasmid complex suspension was added to fully infiltrate the pollen. Cover the petri dish and place it on a MagnetoFACTOR-24 magnetic plate (purchased from Chemicell) for 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for breeding a mung bean sterile mutant based on CRISPR/Cas9 gene editing technology and a special gRNA. The method comprises the following steps of: transferring theCRISPR/Cas9 plasmid of a plant containing a gRNA sequence into a mung bean, thereby editing the ORF region of the mung bean VrPUB4 gene shown in SEQ ID NO. 1, wherein the DNA sequence corresponding tothe gRNA is shown in any one of SEQ ID NO. 2 to SEQ No. 21. According to the invention, the sequence of the gene VrPUB4 shown in SEQ ID NO. 1 is edited by using the CRISPR/Cas9 gene editing technology, wherein an insertion/absence (InDel) in the gene may cause the loss of the gene function due to shift code variation, which may cause a sterile gene editing plant. According to the invention, a newmethod for breeding male sterile mung bean is provided, which provides new germplasm resource for cross breeding of mung beans.

Description

technical field [0001] The invention relates to the fields of molecular breeding, genetic engineering and molecular biology, in particular to a method for breeding mung bean sterile mutants using CRISPR / Cas9 gene editing technology. Background technique [0002] Mung bean (Vigna radiate L.) is one of the main edible bean crops in my country. It is rich in vitamins and minerals, dietary fiber, and protein, and is deeply loved by consumers. However, mung bean varieties are all conventional varieties with low yield, and the yield is generally only 1000 to 1500 kg / ha. Due to the low yield, it is difficult to compete with other field crops, and the area continues to shrink. Therefore how to substantially increase the mung bean yield is an urgent problem that the majority of mung bean breeders must face and solve. [0003] The utilization of heterosis is one of the ways to increase crop yield. Heterosis is a common phenomenon in the biological world. It generally refers to the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N15/113A01H5/02A01H6/54
CPCC12N15/113C12N15/8213C12N15/827C12N2310/10
Inventor 陈景斌林云袁星星薛晨晨顾和平李群三陈新
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap