Vector capable of fast acquiring bastard halibut stable-transfected cell line
A technology of flounder and cells, which is applied in the field of rapidly obtaining vectors for stably transfected cell lines of flounder, which can solve the problems of inability to start downstream genes, lower start-up efficiency, and difficulty in integration, etc., and achieve low integration efficiency, improved efficiency, and low price cheap effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: vector construction process
[0032] The vector construction process is as follows figure 1 As shown, the specific steps are as follows:
[0033] Step 1: The pminiTol2 vector was cut with BglII restriction endonuclease, and the pminiTol2 plasmid was linearized between the Tol2ITR(L) and Tol2ITR(R) transposable elements.
[0034] Step 2: Use PFU DNA Polymerase to mutate the MCS site of the pEGFP-C1 plasmid into a sequence containing only XhoI and XmaI restriction sites by PCR.
[0035] Mutation primers:
[0036] 5'‐ATCAGTTATTCTAGATCCGGTCCGCTCGAGCGGCCCGGGGGGCTTGTACAGCTCGTCCATGC‐3'
[0037] Step 3: Using the mutated pEGFP-C1 plasmid as a template, amplify the SV40Promoter-NeoR / KanR segment by PFU DNA Polymerase, and add 18bp homologous sequences to both ends of the amplification primer for seamless cloning construction vector.
[0038] Amplification primer: FW: 5'‐GCTCTAGATGGCCAGATCCTGAGGCGGAAAGAACCA‐3'
[0039] RV:
[0040] 5'‐GTTTAATTTAAATAGATCTCAGAAG...
Embodiment 2
[0058] Embodiment 2: carrier effect detection
[0059] The embodiment is described by taking the flounder ovary cell line as an example, and it is also applicable to other cell lines of flounder through experimental verification.
[0060] Explanation: Experimental group ① is co-transfection of vector Poβ‐action‐pminiTol2 constructed by optimized Poβ‐action promoter and plasmid pCS‐TP encoding transposase; experimental group ② is vector CMV‐pminiTol2 constructed by CMV promoter and encoding transposase co-transfection with the plasmid pCS‐TP. Control group ① was transfected with pEGFP‐C1 mammalian cell expression vector; control group ② was transfected with pEGFP‐N1 mammalian cell expression vector.
[0061] Step 1: The flounder ovary cells in good growth state were digested with trypsin and passaged to a 12-well plate. When the cells grew to 90-95% confluent, the DMEM-F12 medium without antibiotics was changed the day before transfection.
[0062] Step 2: Experimental group ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


