Unlock instant, AI-driven research and patent intelligence for your innovation.

Vector capable of fast acquiring bastard halibut stable-transfected cell line

A technology of flounder and cells, which is applied in the field of rapidly obtaining vectors for stably transfected cell lines of flounder, which can solve the problems of inability to start downstream genes, lower start-up efficiency, and difficulty in integration, etc., and achieve low integration efficiency, improved efficiency, and low price cheap effect

Inactive Publication Date: 2018-11-02
OCEAN UNIV OF CHINA
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the following problems are still encountered in the process of using liposome method to transfect flounder cells: ① It is difficult to integrate the exogenous gene into the cell genome DNA after the foreign gene is transferred into the flounder cell line, so it is difficult to rely on the traditional Steadily transfected flounder cell lines obtained by screening after liposome transfection
②Exogenous genes successfully transfected into flounder cells are difficult to maintain high-efficiency expression, and the expression efficiency of foreign genes in most successfully transfected flounder cells will disappear within a week, which is significantly lower than that of mammalian cells Expression efficiency of exogenous gene after transfection
[0004] The main reasons for the analysis are as follows: ①After the recombinant plasmid is transferred into the flounder cells, with the prolongation of the screening time, most of the recombinant plasmids will be gradually lost with cell division, and a small part of the remaining plasmids is difficult to integrate into the flounder cells correctly Genomically, this makes it difficult to screen for stable recombinant cell lines
②The CMV promoter on the commonly used mammalian expression vector cannot efficiently and persistently promote the expression of downstream genes in flounder cells. Although the initial efficiency is high, its activation efficiency gradually decreases with time
[0005] Restricted by the above reasons, for a long time, liposome transient transfection has been used in the process of using flounder cell lines to study its gene function, but the stable transfection method commonly used in mammalian cell lines cannot be used. , so it is impossible to obtain a flounder cell line stably transfected with foreign genes, which greatly limits the functional research of gene regulation in flounder

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector capable of fast acquiring bastard halibut stable-transfected cell line
  • Vector capable of fast acquiring bastard halibut stable-transfected cell line
  • Vector capable of fast acquiring bastard halibut stable-transfected cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: vector construction process

[0032] The vector construction process is as follows figure 1 As shown, the specific steps are as follows:

[0033] Step 1: The pminiTol2 vector was cut with BglII restriction endonuclease, and the pminiTol2 plasmid was linearized between the Tol2ITR(L) and Tol2ITR(R) transposable elements.

[0034] Step 2: Use PFU DNA Polymerase to mutate the MCS site of the pEGFP-C1 plasmid into a sequence containing only XhoI and XmaI restriction sites by PCR.

[0035] Mutation primers:

[0036] 5'‐ATCAGTTATTCTAGATCCGGTCCGCTCGAGCGGCCCGGGGGGCTTGTACAGCTCGTCCATGC‐3'

[0037] Step 3: Using the mutated pEGFP-C1 plasmid as a template, amplify the SV40Promoter-NeoR / KanR segment by PFU DNA Polymerase, and add 18bp homologous sequences to both ends of the amplification primer for seamless cloning construction vector.

[0038] Amplification primer: FW: 5'‐GCTCTAGATGGCCAGATCCTGAGGCGGAAAGAACCA‐3'

[0039] RV:

[0040] 5'‐GTTTAATTTAAATAGATCTCAGAAG...

Embodiment 2

[0058] Embodiment 2: carrier effect detection

[0059] The embodiment is described by taking the flounder ovary cell line as an example, and it is also applicable to other cell lines of flounder through experimental verification.

[0060] Explanation: Experimental group ① is co-transfection of vector Poβ‐action‐pminiTol2 constructed by optimized Poβ‐action promoter and plasmid pCS‐TP encoding transposase; experimental group ② is vector CMV‐pminiTol2 constructed by CMV promoter and encoding transposase co-transfection with the plasmid pCS‐TP. Control group ① was transfected with pEGFP‐C1 mammalian cell expression vector; control group ② was transfected with pEGFP‐N1 mammalian cell expression vector.

[0061] Step 1: The flounder ovary cells in good growth state were digested with trypsin and passaged to a 12-well plate. When the cells grew to 90-95% confluent, the DMEM-F12 medium without antibiotics was changed the day before transfection.

[0062] Step 2: Experimental group ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vector capable of achieving efficient and stable transfection in bastard halibuts. The vector adopts a Tol2 transposon, and the Tol2 transposon combines with the plasmid pCS-TP for synthesizing transposase to perform transfection can evidently increase the exogenous gene integrating ability of bastard halibut cells. A neomycin resistance screening marker is added to the vector, so that many recombinant cells can be obtained only by a traditional method combining liposome transfection and resistance screening, and the screening efficiency of the bastard halibut cells being screened to the stable-transfected cell line is increased greatly. An EGFP fluorescent label is added to the vector, so that the expression condition of exogenous genes transfected into the cell line can be conveniently showed in a tracing manner. More importantly, the vector uses an optimized bastard halibut beta-actin promoter to replace a CMV promoter commonly used in a traditional mammal expression vector, the vector more suitable for bastard halibut cell line exogenous gene expression is obtained creatively, and accordingly the exogenous genes can be efficiently and stably expressed in various bastard halibut cell lines.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a carrier capable of rapidly obtaining a stable transfected cell line of flounder. Background technique [0002] Cell transfection is a specialized technology for introducing exogenous molecules such as RNA and DNA into cells, and has become a routine method for studying gene functions in molecular biology and cell biology. At present, the more commonly used methods for cell transfection include liposome method, electroporation method and virus infection method. The electroporation method relies on instantaneous high-pulse voltage to break down the cell membrane, thereby introducing foreign plasmids into the cells. It has a wide range of applications, but the operation is relatively cumbersome, and the lethality of cells after transfection is high. The cells required for transfection And the amount of DNA is large, so it is rarely applicable in the process of cell line t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/65C12N15/85C12N15/88C12N5/10
CPCC12N5/0602C12N15/65C12N15/85C12N15/88C12N2510/00
Inventor 王旭波俞海洋张全启
Owner OCEAN UNIV OF CHINA