Supercharge Your Innovation With Domain-Expert AI Agents!

Application of loading protein gene GmPHF1a of phosphorus transporter gene

A technology for transporting proteins and proteins, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of unreported biological functions of soybeans, and achieve the effect of increasing plant biomass and yield

Inactive Publication Date: 2018-11-02
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether there is an interaction between PHF1 in soybean and the Pht1 family phosphorus transporter, and its biological function in soybean has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of loading protein gene GmPHF1a of phosphorus transporter gene
  • Application of loading protein gene GmPHF1a of phosphorus transporter gene
  • Application of loading protein gene GmPHF1a of phosphorus transporter gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, determination of PHF1 protein

[0029] According to the sequence information of Arabidopsis thaliana and rice PHF1 gene, the candidate gene was screened by Blast in the soybean genome database Phytozome (http: / / www.phytozome.net / soybean), and the obtained gene sequence was carried out in the Arabidopsis thaliana database (TAIR) Blast was used to determine their possible functions, and Phytozome provided information about genes to determine their chromosomal location, and named them according to the Arabidopsis nomenclature (Bucher, 2007). The amino acid sequence of soybean PHF protein was compared with the amino acid sequence of Arabidopsis thaliana and rice PHF1 protein using GENEDOC software for multiple sequence alignment.

[0030] In the published soybean genome database, through homology comparison, it is predicted that there are two members of the soybean PHF phosphorus transporter family, named GmPHF1a and GmPHF1b. The results of multiple sequence a...

Embodiment 2

[0031] Embodiment 2, GmPHF1a gene expression pattern

[0032] The nutrient solution cultivation method was used for planting. One week after the seedlings were raised, the seedlings with uniform growth were selected and soaked in the fresh rhizobia bacterial solution for 30 minutes, then transplanted, and moved into bread boxes filled with different nutrient solutions. The test was a single factor, including low phosphorus (LP: 5 μmol / L) and normal phosphorus (HP: 250 μmol / L) two phosphorus levels; all were low nitrogen (100 μmol / L) and inoculated with rhizobia. 4 replicates. Leaves, stems, root tips, roots, nodules, and flowers were harvested 55 days after transplanting; samples were stored at -80°C for RNA extraction. soybean PHF1a Gene quantitative PCR primer sequences are:

[0033] GmPHF1a-F: TCAGCGATCTCCGAAGAGCTCCA;

[0034] GmPHF1a-R: CGGGCCTCCGAATCCACGAC;

[0035] The quantitative PCR procedure is as follows: the cDNA obtained by the reverse transcription of the ...

Embodiment 3

[0039] Example 3, the subcellular localization of GmPHF1a

[0040] 1 Vector Construction

[0041] according to GmPHF1a Design primers for the full-length cDNA sequence, and add Bam HI restriction site, the primers are as follows:

[0042] PHF1aF: GTggatccATGCTCTCATTTTCGTCTCTGACAT;

[0043] PHF1aR: GTggatccTCagTCACATATCTACTGGCCCCCAA;

[0044] GmPHF1a was fused to the pBI121-GFP vector. cDNA from wild-type soybean root was amplified with Ex Taq (TAKALA, Japan) GmPHF1a For the gene fragment, the PCR product was recovered and connected to the pBI121-GFP vector with the corresponding enzyme digestion, and the clones were selected for enzyme digestion detection and sequencing, and the correctly fused clones were saved for future use. After obtaining the required recombinant vector, transform the plasmid into Agrobacterium GV3101 competent cells, and shake the bacteria for later use.

[0045] 2 Tobacco Transformation

[0046] The GV3101-positive clones containing the recombi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of loading protein gene GmPHF1a of a phosphorus transporter gene and particularly relates to application of gene GmPHF1a in terms of promoting phosphorus acquisitionin leguminous plants to promote nodulation and nitrogen fixing, and nitrogen increasing via phosphorus. The gene GmPHF1a that has expression in all leaves, stems, roots and nodules is cloned throughquantitative PCR (polymerase chain reaction); it is proved that a protein encoded by the gene GmPHF1a can interact with phosphorus transporter protein GmPT5 / GmPT7, which controls phosphorus absorptionand transport in nodules, the nodule quantity and nodule weight can be significantly increased by interference of GmPHF1a, nitrogen content, phosphorus content and biomass quantity are increased, andsoybean yield is significantly increased.

Description

technical field [0001] The present invention relates to the application of genes, in particular to the loading protein gene of phosphorus transporter GmPHF1a The application in increasing nitrogen by phosphorus in leguminous crops belongs to the field of biotechnology. Background technique [0002] Soybean is one of the leguminous crops with the largest planting area in the world. It can form root nodules symbiotically with rhizobia in the soil and carry out biological nitrogen fixation, playing an irreplaceable role in the agricultural ecosystem (Udvardi and Poole, 2013). Phosphorus is one of the essential nutrients for plant growth and development, and plays an important role in root nodule growth and nitrogen fixation (Qinet al., 2012). And there is an effect of "increasing nitrogen with phosphorus" in soybean production, but there are few studies on its physiological and molecular mechanisms. Qin et al. found that maintaining phosphorus balance in soybean root nodules ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29
CPCC12N15/8261C07K14/415
Inventor 廖红陈丽玉李欣欣
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More