Application of abc transporter as a target in pest control
A technology for transporting proteins and preventing and controlling pests, applied in the fields of application, pesticides, recombinant DNA technology, etc., can solve problems such as control difficulties, and achieve the effect of reducing LC50 and increasing sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Cloning of ABCB6 Gene of Cotton Bollworm
[0035] The amino acid sequences encoded by the ABCB6 genes of silkworm (XP_012550859.1), Spodoptera litura (XP_022837972.1), and human (NP_005680.1) were used for homology detection, and the regions with high homology were selected to design amplification primers for conservation area expansion. Primers are listed in Table 1.
[0036] Table 1 Primers
[0037]
[0038]
[0039] 5' and 3' RACE experiments were performed using the conserved region as a template, and the RACE experiment was performed according to RACE cDNA Amplifiction Kit instructions for operation.
[0040] The RACE amplification result was compared with the existing transcriptome data to confirm the reliability of the sequence, and the ABCB6 gene of cotton bollworm was obtained, the sequence of which is shown in SEQ ID NO.1.
Embodiment 2
[0042] Knockout of ABCB6 Gene in Cotton Bollworm
[0043] 1. sgRNA design and synthesis
[0044] Using sgRNAcas9 design software to design the sgRNA site of ABCB6 gene, the whole genome was used as the reference sequence for off-target risk assessment, and the N18NGG sequence with the highest score and no off-target risk was selected as sgRNA (sgRNA1-F: GGTGAGATATGGGTGGACCA; sgRNA1-R: TGGTCCACCCATATCTCACCC) .
[0045] Add TAATACGACTCACTATAG and TTCTAGCTCTAAAAC linker sequences (T7 promoter) in front of the forward / reverse sgRNA sequences, respectively, using GeneArt TM The Precision gRNA Synthesis Kit was used to synthesize sgRNA in vitro according to its operating instructions.
[0046] The configuration system is shown in Table 2.
[0047] Table 2 configuration system
[0048] Reagent Usage (volume) High-Fidelity PCR Master Mix(2X) 12.5μL Tracr Fragment+T7 Primer Mix 1μL 0.3μM Target F1 / R1 oligonucleotide mix 1μL Nuclease-free Water...
Embodiment 3
[0068] Collection and Injection of Cotton Bollworm Eggs
[0069] 20 pairs of cotton bollworm adults were placed in a 30cm×20cm insect rearing box, covered with gauze, and fed with 10% sugar water. During the peak period of spawning, replace the egg cloth, and collect the gauze after 2 hours. Soak the gauze in 1% sodium hypochlorite solution for 10 seconds, then place it in clear water and stir to wash off the eggs on the gauze. For the convenience of injection, place the eluted eggs one by one on a glass slide stained with double-sided tape.
[0070] Take out the sgRNA solution and Cas9 protein in Example 2 from the refrigerator, and dilute them to 150ng / μL and 50ng / μL, respectively. Mix the two in equal volumes, inject 2nL of the mixture into each egg, and place the injected eggs in an incubator.
[0071] mutation detection
[0072] 20 larvae hatched and were fed with artificial feed until they pupated, and 16 larvae successfully emerged into adults. After mating and lay...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com