Supercharge Your Innovation With Domain-Expert AI Agents!

Application of abc transporter as a target in pest control

A technology for transporting proteins and preventing and controlling pests, applied in the fields of application, pesticides, recombinant DNA technology, etc., can solve problems such as control difficulties, and achieve the effect of reducing LC50 and increasing sensitivity

Inactive Publication Date: 2020-11-03
AGRI GENOME INST OF SHENZHEN CHINESE ACADEMY OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cotton bollworm has strong environmental adaptability, easy to produce drug resistance and also has the characteristics of migration, so it is difficult to control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of abc transporter as a target in pest control
  • Application of abc transporter as a target in pest control
  • Application of abc transporter as a target in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Cloning of ABCB6 Gene of Cotton Bollworm

[0035] The amino acid sequences encoded by the ABCB6 genes of silkworm (XP_012550859.1), Spodoptera litura (XP_022837972.1), and human (NP_005680.1) were used for homology detection, and the regions with high homology were selected to design amplification primers for conservation area expansion. Primers are listed in Table 1.

[0036] Table 1 Primers

[0037]

[0038]

[0039] 5' and 3' RACE experiments were performed using the conserved region as a template, and the RACE experiment was performed according to RACE cDNA Amplifiction Kit instructions for operation.

[0040] The RACE amplification result was compared with the existing transcriptome data to confirm the reliability of the sequence, and the ABCB6 gene of cotton bollworm was obtained, the sequence of which is shown in SEQ ID NO.1.

Embodiment 2

[0042] Knockout of ABCB6 Gene in Cotton Bollworm

[0043] 1. sgRNA design and synthesis

[0044] Using sgRNAcas9 design software to design the sgRNA site of ABCB6 gene, the whole genome was used as the reference sequence for off-target risk assessment, and the N18NGG sequence with the highest score and no off-target risk was selected as sgRNA (sgRNA1-F: GGTGAGATATGGGTGGACCA; sgRNA1-R: TGGTCCACCCATATCTCACCC) .

[0045] Add TAATACGACTCACTATAG and TTCTAGCTCTAAAAC linker sequences (T7 promoter) in front of the forward / reverse sgRNA sequences, respectively, using GeneArt TM The Precision gRNA Synthesis Kit was used to synthesize sgRNA in vitro according to its operating instructions.

[0046] The configuration system is shown in Table 2.

[0047] Table 2 configuration system

[0048] Reagent Usage (volume) High-Fidelity PCR Master Mix(2X) 12.5μL Tracr Fragment+T7 Primer Mix 1μL 0.3μM Target F1 / R1 oligonucleotide mix 1μL Nuclease-free Water...

Embodiment 3

[0068] Collection and Injection of Cotton Bollworm Eggs

[0069] 20 pairs of cotton bollworm adults were placed in a 30cm×20cm insect rearing box, covered with gauze, and fed with 10% sugar water. During the peak period of spawning, replace the egg cloth, and collect the gauze after 2 hours. Soak the gauze in 1% sodium hypochlorite solution for 10 seconds, then place it in clear water and stir to wash off the eggs on the gauze. For the convenience of injection, place the eluted eggs one by one on a glass slide stained with double-sided tape.

[0070] Take out the sgRNA solution and Cas9 protein in Example 2 from the refrigerator, and dilute them to 150ng / μL and 50ng / μL, respectively. Mix the two in equal volumes, inject 2nL of the mixture into each egg, and place the injected eggs in an incubator.

[0071] mutation detection

[0072] 20 larvae hatched and were fed with artificial feed until they pupated, and 16 larvae successfully emerged into adults. After mating and lay...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of an ABC transporter as a target to pest control. Gene ABCB6 of Helicoverpa armigera is knocked out with a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR-associated nuclease 9) gene editing technology, the sequence of the gene ABCB6 is determined with an RACE technology and existing transcriptome data, a sgRNA target site is designed according to the sequence, after in-vitro transcription of sgRNA, sgRNA and Cas9 protein are mixed proportionally and injected into Helicoverpa armigera eggs, knockout of the gene ABCB6 succeeds,and a 7bp-deleted homozygous knockout strain is obtained through two-generation hybrid screening and purification. A detection result shows that weight gain of the knockout strain in treatment with gossypol concentration being 0.4% is inhibited seriously, meanwhile, sensibility to indoxacarb is improved, and LC50 is reduced 3.3 times. The results prove that the gene ABCB6 plays an important rolein indoxacarb and gossypol metabolism of the Helicoverpa armigera, and the new target gene is provided for controlling the Helicoverpa armigera.

Description

technical field [0001] The invention relates to the field of pest control, in particular to the application of ABC transporter as a target in pest control. Background technique [0002] ABC transporters are an ancient and large family of transmembrane proteins that widely exist in organisms in nature. Most ABC transporters have transport activity, and use the energy generated by ATP hydrolysis against the concentration gradient to transport substrates across the membrane. The transport substrates include amino acids, lipids, sugars, metal ions, metabolites, and drugs. [0003] P-glycoprotein is the first ABC transporter found in eukaryotes, and it is also called multidrug resistance transporter (MDR) because it participates in the efflux of intracellular drugs. ABC transporter performs the function of transmembrane transport in phase III of insect detoxification metabolic pathway, and its function is gradually revealed. For example, the tobacco hornworm (Manduca sexta) can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N57/16C12N15/113A01P7/04
CPCA01N57/16C12N15/113C12N2310/14
Inventor 萧玉涛靳明辉程英廖重宇
Owner AGRI GENOME INST OF SHENZHEN CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More