Construction of gene expression vector Wxb-10T, preparation of transgenic rice and primer
A technology of transgenic rice, wxb-10t, which is applied in the field of plant genetic engineering, can solve the problems of time-consuming gene resources, singleness, etc., and achieve the effects of improving eating taste, improving eating quality, and reducing the viscosity value of rice starch.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 The acquisition of DNA sequence and the construction of gene expression vector
[0032] According to the whole genome information of rice, the wxya b After the coding sequence of the allele, design specific primer pairs in two sections wxya b The genome was amplified (the first pair of primers 5'TAAGCTTTAGATCCGCTGCCGCCCCGAAT3', SEQ ID NO.3; and 5'CGCCTGCAAAGAACACAAGAACACAACATT3', SEQ ID NO.4; the second primer for site-directed mutagenesis 1 5'AACAATTCAATTCAGTGCAGAGATCTTCCACA3', SEQ ID NO.5 ; CCATGACGTCAGAGCCCTTCTGTTCC3', SEQ ID NO.6; and site-directed mutagenesis primer 2 5'GGAACAGAAGGGCTCTGACGTCATGG3', SEQ ID NO.7; 5'TGGTACCTGAACTTGACGTAGACAGACGTACGATA3', SEQ ID NO.8) for wxya b Construction of site-directed replacement of functional bases in exon 10. The amplified sequences are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0033] Take the young rice leaves of japonica Nipponbare to extract rice genomic DNA by CTAB method, use 1 μL of DNA as a template, and ...
Embodiment 2
[0035] Example 2 contains wxya b -10T Breeding and identification of expression vector transgenic rice
[0036] Rice tissue culture and Agrobacterium-mediated transformation procedures are all carried out by the method established in the inventor's laboratory (Liu Qiaoquan, etc., the establishment of rice efficient transformation system mediated by Agrobacterium tumefaciens, Plant Physiology, 1998, 24 (3) : 259~271). Using Nipponbare mature embryos as explants, callus was induced on N6D2 medium as the transformation recipient, and the constructed RNA interference construct was introduced into rice callus through Agrobacterium-mediated; co-cultured on co-culture medium N6D2C After 3 days, the callus was transferred to N6D2S1 selection medium for screening for about 14 days, and then screened on N6D2S2 selection medium, and the times and days of selection were adjusted according to the actual growth of the callus. A lot of resistant calli were obtained, and after pre-differe...
Embodiment 3
[0037] Example 3 Quality performance of transgenic rice
[0038] Measure the amylose content of rice according to the document method numbered NY147-88 promulgated by the Ministry of Agriculture. Accurately weigh 50 mg of rice flour on a ten-thousandth balance and put it into a 50 ml test tube, add 0.5 ml of absolute ethanol to disperse the sample , then add 4.5ml of 1.0 mol / l NaOH solution and mix well, put in boiling water bath for 20 min, then cool to room temperature, and distilled water to make up to volume. Take 5 ml of digestion solution, add it to a 100mL volumetric flask filled with half a bottle of distilled water, then add 1.0 ml of 1.0 mol / l acetic acid solution to acidify the sample; add 1.5 ml of 0.02% iodine solution, dilute to volume with distilled water, and shake well After standing still for 15 minutes; add 0.5ml of 95% ethanol to 4.5ml of 1N NaOH to replace the sample, and prepare a blank solution. Use the blank solution to adjust the zero point of the spe...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com