Primers, probe, kit and method for detecting European virus of PRRSV based on digital PCR technology
A technical detection, European-type technology, applied in the field of molecular biology, to achieve accurate diagnosis basis, high sensitivity, and not easily affected
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Establishment of a kit for absolute quantitative detection of PRRSV European type virus based on digital PCR technology
[0045] Kit for absolute quantitative detection of PRRSV European virus based on digital PCR technology, including primer set, 2×RT-ddPCR Supermix, RNase-free distilled water, virus total RNA extraction reagent, positive control and negative control.
[0046] (1) Design of primers for digital PCR amplification: primers were designed with the specific conserved sequence of PRRSV European virus as the target gene. The primer sequences are listed in Table 1.
[0047] Table 1 Primer sequence list
[0048] Primer name
Primer sequence (5`-3`)
FP
AAAGCCTGAGAAGCCACATTTT (SEQ ID NO: 1)
BP
GGTGGTGCCGGATGTCAT (SEQ ID NO: 2)
Probe
CCCTGGCTGCTGAA (SEQ ID NO: 3)
[0049] (2) The molar ratio of FP primer, BP primer and probe in the primer set is 3:3:2.
[0050] (3) 2×RT-ddPCR Supermix contains: 2×One-step...
Embodiment 2
[0053] Embodiment 2 Absolute Quantitative Detection Method of PRRSV European Type Virus Based on Digital PCR Technology
[0054] Utilize the method for the kit detection PRRSV European type virus of embodiment 1, comprises the steps:
[0055] (1) Extraction of viral RNA:
[0056] 1) Take the sample to be tested and the positive control, add 600ul lysate A respectively, vortex and mix for 20 seconds, and let stand at room temperature for 10 minutes;
[0057] 2) Transfer the mixture to an adsorption column and centrifuge at 12,000×g for 30-60 seconds;
[0058] 3) Discard the liquid in the collection tube, add 500ul washing solution B to the adsorption column, and centrifuge at 12,000×g for 30-60 seconds;
[0059] 4) Discard the liquid in the collection tube, add 500ul washing solution C to the adsorption column, and centrifuge at 12,000×g for 30-60 seconds;
[0060] 5) Discard the liquid in the collection tube, and centrifuge at 12,000×g for 2 minutes to dry the column;
[0...
Embodiment 3
[0079] Example 3 specificity verification
[0080] Use the kit of the present invention to detect serum samples of healthy pigs, clinically obtained pseudorabies virus, porcine respiratory and reproductive syndrome American type virus, swine fever virus, porcine epidemic diarrhea virus, porcine circovirus, porcine transmissible gastroenteritis There are 9 samples of virus, Streptococcus suis, and porcine pleurisy samples. All samples have been verified by sequencing methods. The test results are shown in figure 1 .
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap