Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers, probe, kit and method for detecting European virus of PRRSV based on digital PCR technology

A technical detection, European-type technology, applied in the field of molecular biology, to achieve accurate diagnosis basis, high sensitivity, and not easily affected

Inactive Publication Date: 2018-12-11
JINAN UNIVERSITY
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing technology does not use digital PCR technology to carry out relevant research on the absolute quantitative detection of PRRSV European virus, whether it is feasible, and the finished kit suitable for industrialization.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probe, kit and method for detecting European virus of PRRSV based on digital PCR technology
  • Primers, probe, kit and method for detecting European virus of PRRSV based on digital PCR technology
  • Primers, probe, kit and method for detecting European virus of PRRSV based on digital PCR technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Establishment of a kit for absolute quantitative detection of PRRSV European type virus based on digital PCR technology

[0045] Kit for absolute quantitative detection of PRRSV European virus based on digital PCR technology, including primer set, 2×RT-ddPCR Supermix, RNase-free distilled water, virus total RNA extraction reagent, positive control and negative control.

[0046] (1) Design of primers for digital PCR amplification: primers were designed with the specific conserved sequence of PRRSV European virus as the target gene. The primer sequences are listed in Table 1.

[0047] Table 1 Primer sequence list

[0048] Primer name

Primer sequence (5`-3`)

FP

AAAGCCTGAGAAGCCACATTTT (SEQ ID NO: 1)

BP

GGTGGTGCCGGATGTCAT (SEQ ID NO: 2)

Probe

CCCTGGCTGCTGAA (SEQ ID NO: 3)

[0049] (2) The molar ratio of FP primer, BP primer and probe in the primer set is 3:3:2.

[0050] (3) 2×RT-ddPCR Supermix contains: 2×One-step...

Embodiment 2

[0053] Embodiment 2 Absolute Quantitative Detection Method of PRRSV European Type Virus Based on Digital PCR Technology

[0054] Utilize the method for the kit detection PRRSV European type virus of embodiment 1, comprises the steps:

[0055] (1) Extraction of viral RNA:

[0056] 1) Take the sample to be tested and the positive control, add 600ul lysate A respectively, vortex and mix for 20 seconds, and let stand at room temperature for 10 minutes;

[0057] 2) Transfer the mixture to an adsorption column and centrifuge at 12,000×g for 30-60 seconds;

[0058] 3) Discard the liquid in the collection tube, add 500ul washing solution B to the adsorption column, and centrifuge at 12,000×g for 30-60 seconds;

[0059] 4) Discard the liquid in the collection tube, add 500ul washing solution C to the adsorption column, and centrifuge at 12,000×g for 30-60 seconds;

[0060] 5) Discard the liquid in the collection tube, and centrifuge at 12,000×g for 2 minutes to dry the column;

[0...

Embodiment 3

[0079] Example 3 specificity verification

[0080] Use the kit of the present invention to detect serum samples of healthy pigs, clinically obtained pseudorabies virus, porcine respiratory and reproductive syndrome American type virus, swine fever virus, porcine epidemic diarrhea virus, porcine circovirus, porcine transmissible gastroenteritis There are 9 samples of virus, Streptococcus suis, and porcine pleurisy samples. All samples have been verified by sequencing methods. The test results are shown in figure 1 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers, a probe, kit and method for detecting an European virus of a PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) based on a digital PCR technology. The primersand the probe include an upstream primer FP, a downstream primer BP and a probe Probe; the kit comprises a primer group, 2*RT-ddPCR Supermix, distilled water containing no RNA enzymes, a virus totalRNA extracting reagent, negative control and positive control. The method comprises the steps: extracting the RNA of a to-be-detected sample, quantitatively detecting the RNA of the to-be-detected sample by using a microdrop digital PCR technology, judging whether the to-be-detected sample contains the European virus of the PRRSV or not according to a copy number obtained by amplification analysis, and measuring the content of the European virus of the PRRSV. The primers, the probe, the kit and the method have the advantages such as accuracy, sensitivity, high applicability, no dependency on standard curves and capability of realizing absolute quantification, the early discovery and early prevention of PRRS diagnosis can be realized, and the outbreak of an epidemic situation can be effectively controlled. No kits for quantitatively detecting the European virus of the PRRSV by applying the digital PCR technology are provided at present.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer, a probe, a kit and a method for detecting PRRSV European virus based on digital PCR technology. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS) is a viral infectious disease that seriously endangers the pig industry caused by porcine reproductive and respiratory syndrome virus (PRRSV), clinical symptoms For pregnant sows premature birth, miscarriage, stillbirth and mummified fetuses and piglets have breathing difficulties. PRRSV belongs to the Arteriviridae Arterivirus genus. Its genome is a single-stranded positive-sense RNA with a size of about 15 kb, including 10 open reading frames, 5' non-coding regions and 3' non-coding regions. According to the genotype difference of PRRSV, it can be divided into American type and European type. Among them, there are many reports on the identification and detection methods of American t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2563/159C12Q2563/107
Inventor 叶蕾曹炜伟陈洵常彦磊李丽丽石磊
Owner JINAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More