Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A replication-deficient recombinant influenza virus expressing both HA and hef

An influenza virus and recombinant virus technology, applied in the field of influenza virus vaccine technology research and development, can solve the problems of virulence reversion mutation, poor antigenicity, and long period of research and development of low temperature-adapted strains, so as to maintain immunogenicity and strong mucosal immune response. and cellular immune response levels, strong and durable immunogenicity

Active Publication Date: 2021-09-24
QINGDAO AGRI UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, influenza vaccine is the main method to prevent and control the prevalence of influenza virus. Commonly used influenza vaccines include inactivated vaccine and attenuated vaccine: the main problem with inactivated vaccine is that it has poor antigenicity and can only induce antibody immunity; attenuated influenza vaccine is low temperature adaptation to influenza virus. strains, which can induce strong antibody immune response and cellular immune response at the same time, but the currently approved attenuated influenza vaccine strains can only express one subtype of HA, and the development cycle of low-temperature adaptation strains is long, and there are potential viruses. Potential danger of reverting mutations; and there is currently no vaccine against influenza D viruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A replication-deficient recombinant influenza virus expressing both HA and hef
  • A replication-deficient recombinant influenza virus expressing both HA and hef
  • A replication-deficient recombinant influenza virus expressing both HA and hef

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Reverse transcribe the RNA fragments of PB2, PB1, PA, HA, NP, M, and NS of type A influenza virus subtype H1N1 in vitro to make cDNA, use the cDNA as a template to amplify the gene fragments of influenza virus, and clone them into Expression vector plasmid pHW2000. Seven plasmids were obtained, namely pHW-PB2, pHW-PB1, pHW-PA, pHW-HA, pHW-NP, pHW-M, and pHW-NS.

[0028] 2. Construction of plasmid pHW-NA-HEF

[0029] The newly constructed plasmid pHW-NA-HEF ( figure 1 ): at first the DNA sequence NA-HEF (Genscript Company) was synthesized, which retained 202 nucleotides of the 3' non-coding region of the H1N1NA fragment of type A influenza virus and 185 nucleotides of the 5' non-coding region Wrap signal. Utilize PCR technology to carry out the amplification of target fragment NA (202nt)-ORF (HEF)-NA (185nt) (such as figure 2 ).

[0030] Upstream primer sequence: TATTGGTCTCAGGGAGCAAAAGCAGGAGT,

[0031] Downstream primer sequence: ATATGGTCTCGTATTAGTAGAAACAAGGAGT...

Embodiment 2

[0034] Embodiment 2 rescues recombinant virus

[0035] Construction of cell lines: construction of MDCK cell lines that can stably express A / Califronia / 2009 / 07 (H1N1) influenza virus surface glycoprotein neuraminidase NA.

[0036] Specific steps are as follows:

[0037] G418 selection of stable expression cell lines:

[0038] Before screening, determine the optimal concentration of G418 for screening MDCK cells is 500 μg / mL.

[0039] Preparation of G418: Dissolve 1g of G418 in 1mL of 1M HEPES solution, add ultrapure water to 10mL, filter, and store at 4°C for later use.

[0040] (1) The RNA fragment of the surface glycoprotein neuraminidase NA of type A influenza virus subtype H1N1 was reverse-transcribed in vitro to make cDNA, and the NA gene fragment of influenza virus was amplified with cDNA as a template, and cloned into the vector plasmid pD2EGFP- on N1. The plasmid pD2EGFP-NA was obtained.

[0041] (2) Spread MDCK cells on a 6-well plate and culture them in MEM medi...

Embodiment 3

[0053] Embodiment 3 tests the growth curve of recombinant virus

[0054] MDCK cells stably expressing NA were cultured in MEM medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) and 1% double antibody (Penicillin-Streptomycin Solution, PS) in a 37°C incubator. (Media and serum were purchased from Biological Industries Company.) The transformed MDCK cells were plated in 6-well cell culture plates, 3×10 per well 5 cells, the virus will be amplified when the cell growth density reaches 50%-60%. Before virus amplification, wash the transformed MDCK cells with phosphate buffer saline (Phosphate Buffer Saline, PBS) twice, infect the cells with the recombinant virus with MoI=0.001, and replace it with 2 mL containing 0.2% bovine serum albumin after 1 hour of adsorption. Protein (Bovine SerumActin, BSA) and 1 μg / mL TPCK in MEM culture solution, and then the supernatant was collected at 24, 48 and 72 hours after infection and stored at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing the attenuated live vaccine of replication-deficient type A and D bivalent influenza virus. The present invention constructs a recombinant virus strain, without changing the genetic stability precursor, the recombinant virus constructed can stably express the surface protein hemagglutinin HA of type A influenza virus H1N1 subtype and the only HA of type D influenza virus Surface protein hemagglutinin esterase fusion protein HEF. The constructed attenuated strain not only has good gene stability but also cannot replicate in experimental animals, so it is not pathogenic, and can also induce a strong mucosal immune response and cellular immune response in the body, maintaining a strong and long-lasting immunogenicity. The most important thing is that the candidate vaccine strain can produce immune protection against both type A influenza virus H1N1 subtype and type D influenza virus. So the prevention and control of type A and type D influenza has great social significance.

Description

technical field [0001] The invention belongs to the field of research and development of influenza virus vaccine technology, in particular to the preparation of a recombinant influenza virus capable of simultaneously expressing the surface protein hemagglutinin HA of type A influenza virus H1N1 and the fusion protein HEF of the only surface protein hemagglutinin esterase of type D influenza virus Methods and uses. Background technique [0002] Influenza is an infectious disease that is caused by influenza virus (Influenza Virus) and seriously endangers the respiratory system of humans and animals. Influenza viruses are divided into three types (IAV, IBV, ICV) according to their nucleoprotein antigenicity differences, and the influenza viruses that infect humans are mainly types A and B. Influenza D virus (IDV) is a new type of influenza virus discovered in recent years, which infects humans and mammals. [0003] At present, influenza vaccine is the main method to prevent a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01C07K16/10A61K39/145A61P31/16
CPCA61K39/12A61K2039/5254A61P31/16C07K14/005C07K16/1018C12N7/00C12N2760/16021C12N2760/16022C12N2760/16034C12N2760/16122C12N2760/16134
Inventor 李军伟孙明宏刘博单虎
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com