Replication-defective recombinant influenza virus for simultaneously expressing HA and HEF

A technology for replication-deficient influenza virus, applied in the field of preparation of recombinant influenza virus, which can solve the problems of virulence reversal mutation, poor antigenicity, and long development cycle of cold-adapted virus strains, so as to maintain immunogenicity and strong mucosal immunity Response and cellular immune response levels, effects of strong and long-lasting immunogenicity

Active Publication Date: 2018-12-28
QINGDAO AGRI UNIV
View PDF12 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, influenza vaccine is the main method to prevent and control the prevalence of influenza virus. Commonly used influenza vaccines include inactivated vaccine and attenuated vaccine: the main problem with inactivated vaccine is that it has poor antigenicity and can only induce antibody immunity; attenuated influenza vaccine is low temperature adaptation to influenza virus. strains, which can induce strong antibody immune response and cellular immune response at the same time, but the currently approved attenuated influenza vaccine strains can only express one subtype of HA, and the development cycle of low-temperature adaptation strains is long, and there are potential viruses. Potential danger of reverting mutations; and there is currently no vaccine against influenza D viruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Replication-defective recombinant influenza virus for simultaneously expressing HA and HEF
  • Replication-defective recombinant influenza virus for simultaneously expressing HA and HEF
  • Replication-defective recombinant influenza virus for simultaneously expressing HA and HEF

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Reverse transcribe the RNA fragments of PB2, PB1, PA, HA, NP, M, and NS of type A influenza virus subtype H1N1 in vitro to make cDNA, use the cDNA as a template to amplify the gene fragments of influenza virus, and clone them into Expression vector plasmid pHW2000. Seven plasmids were obtained, namely pHW-PB2, pHW-PB1, pHW-PA, pHW-HA, pHW-NP, pHW-M, and pHW-NS.

[0028] 2. Construction of plasmid pHW-NA-HEF

[0029] The newly constructed plasmid pHW-NA-HEF ( figure 1 ): at first the DNA sequence NA-HEF (Genscript Company) was synthesized, which retained 202 nucleotides of the 3' non-coding region of the H1N1NA fragment of type A influenza virus and 185 nucleotides of the 5' non-coding region Wrap signal. Utilize PCR technology to carry out the amplification of target fragment NA (202nt)-ORF (HEF)-NA (185nt) (such as figure 2 ).

[0030] Upstream primer sequence: TATTGGTCTCAGGGAGCAAAAGCAGGAGT,

[0031] Downstream primer sequence: ATATGGTCTCGTATTAGTAGAAACAAGGAGT...

Embodiment 2

[0034] Embodiment 2 rescues recombinant virus

[0035] Construction of cell lines: construction of MDCK cell lines that can stably express A / Califronia / 2009 / 07 (H1N1) influenza virus surface glycoprotein neuraminidase NA.

[0036] Specific steps are as follows:

[0037] G418 selection of stable expression cell lines:

[0038] Before screening, determine the optimal concentration of G418 for screening MDCK cells is 500 μg / mL.

[0039] Preparation of G418: Dissolve 1g of G418 in 1mL of 1M HEPES solution, add ultrapure water to 10mL, filter, and store at 4°C for later use.

[0040] (1) The RNA fragment of the surface glycoprotein neuraminidase NA of type A influenza virus subtype H1N1 was reverse-transcribed in vitro to make cDNA, and the NA gene fragment of influenza virus was amplified with cDNA as a template, and cloned into the vector plasmid pD2EGFP- on N1. The plasmid pD2EGFP-NA was obtained.

[0041] (2) Spread MDCK cells on a 6-well plate and culture them in MEM medi...

Embodiment 3

[0053] Embodiment 3 tests the growth curve of recombinant virus

[0054] MDCK cells stably expressing NA were cultured in MEM medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) and 1% double antibody (Penicillin-Streptomycin Solution, PS) in a 37°C incubator. (Media and serum were purchased from Biological Industries Company.) The transformed MDCK cells were plated in 6-well cell culture plates, 3×10 per well 5 cells, the virus will be amplified when the cell growth density reaches 50%-60%. Before virus amplification, wash the transformed MDCK cells with phosphate buffer saline (Phosphate Buffer Saline, PBS) twice, infect the cells with the recombinant virus with MoI=0.001, and replace it with 2 mL containing 0.2% bovine serum albumin after 1 hour of adsorption. Protein (Bovine SerumActin, BSA) and 1 μg / mL TPCK in MEM culture solution, and then the supernatant was collected at 24, 48 and 72 hours after infection and stored at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a replication-defective A and D divalent influenza virus attenuated live vaccine. The invention constructs a recombinant virus strain; on the premise ofnot changing gene stability, the constructed recombinant virus can stably and simultaneously express surface protein hemagglutinin HA of A type influenza virus H1N1 subtype and unique surface proteinhemagglutinin esterase fusion protein HEF of D type influenza virus. The constructed attenuated strain has good gene stability and cannot be replicated in an experimental animal body, so the constructed attenuated strain has no pathogenicity; meanwhile, the constructed attenuated strain also can induce a body to produce strong mucosal immune response and cellular immune response level and keeps intense and durable immunogenicity. The key is that a vaccine candidate strain can produce an immunoprotection action on the A type influenza virus H1N1 subtype and the D type influenza virus. Therefore, the replication-defective A and D divalent influenza virus attenuated live vaccine has huge social significance in preventing and controlling A type and D type influenza.

Description

technical field [0001] The invention belongs to the field of research and development of influenza virus vaccine technology, in particular to the preparation of a recombinant influenza virus capable of simultaneously expressing the surface protein hemagglutinin HA of type A influenza virus H1N1 and the fusion protein HEF of the only surface protein hemagglutinin esterase of type D influenza virus Methods and uses. Background technique [0002] Influenza is an infectious disease that is caused by influenza virus (Influenza Virus) and seriously endangers the respiratory system of humans and animals. Influenza viruses are divided into three types (IAV, IBV, ICV) according to their nucleoprotein antigenicity differences, and the influenza viruses that infect humans are mainly types A and B. Influenza D virus (IDV) is a new type of influenza virus discovered in recent years, which infects humans and mammals. [0003] At present, influenza vaccine is the main method to prevent a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C07K16/10A61K39/145A61P31/16
CPCA61K39/12A61K2039/5254A61P31/16C07K14/005C07K16/1018C12N7/00C12N2760/16021C12N2760/16022C12N2760/16034C12N2760/16122C12N2760/16134
Inventor李军伟孙明宏刘博单虎
OwnerQINGDAO AGRI UNIV