Preparation method and application of humanized CD28 gene remolding animal model
An animal model, humanized technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc., can solve the problem of inability to identify mouse Cd28, low accuracy, inability to screen and evaluate targeting Human CD28 drug efficacy and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0189] Example 1 Design of Cd28 gene sgRNA
[0190] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.
[0191] Design and synthesize sgRNA sequences that recognize the 5' target site (sgRNA1-sgRNA12) and the 3' target site (sgRNA13-sgRNA20). The 5' target site is located on exon 2 of the Cd28 gene, and the 3' target site is located on exon 3 of the Cd28 gene. The target site sequences of each sgRNA sequence on Cd28 are as follows:
[0192] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-ctcggcattcgagcgaaactggg-3'
[0193] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-tgccgagttcaactgcgacgggg-3'
[0194] sgRNA-3 target site sequence (SEQ ID NO: 3): 5'-cgctgttcacgcccttgtacagg-3'
[0195] sgRNA-4 target site sequence (SEQ ID NO: 4): 5'-caagggcgtgaacagcgacgtgg-...
Embodiment 2
[0212] Example 2 Screening of Cd28 gene sgRNA
[0213] UCA kit was used to detect the activities of multiple sgRNAs. The results showed that the sgRNAs had different activities. For the test results, see figure 1 and Table 1. According to the results of activity detection, sgRNA4 and sgRNA17 were selected for subsequent experiments. The upstream and downstream single-strand sequences of sgRNA4 and sgRNA17 are as follows:
[0214] sgRNA4 sequence:
[0215] Upstream: 5'-GCGTGAACAGCGACG-3' (SEQ ID NO: 21)
[0216] Downstream: 5'-CGTCGCTGTTCACGC-3' (SEQ ID NO: 22)
[0217] sgRNA17 sequence:
[0218] Upstream: 5'-TCATCTCCTAAGCTGTTT-3' (SEQ ID NO: 23)
[0219] Downstream: 5'-AAACAGCTTAGGAGATGA -3' (SEQ ID NO: 24)
[0220] Table 1 sgRNA activity detection results
[0221]
[0222]
Embodiment 3
[0223] Example 3 pT7-sgRNA G2 plasmid construction
[0224] The fragmented DNA containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector pHSG299 by restriction enzyme digestion (EcoRI and BamHI) in sequence. After sequencing verification by a professional sequencing company, the results showed that the target plasmid: pT7-sgRNAG2 plasmid was obtained , see the pT7-sgRNA G2 plasmid map figure 2 .
[0225] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 25):
[0226]gaattctaatacgactcactataggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com