Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of humanized CD28 gene remolding animal model

An animal model, humanized technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc., can solve the problem of inability to identify mouse Cd28, low accuracy, inability to screen and evaluate targeting Human CD28 drug efficacy and other issues

Active Publication Date: 2019-01-04
BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD
View PDF15 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] During the research and development of CD28 target-related drugs, since the amino acid sequence homology between the Cd28 protein of rodents such as mice and human CD28 protein is about 68%, generally speaking, antibodies that recognize human CD28 protein cannot recognize small Mouse Cd28, that is, ordinary mice cannot be used to screen and evaluate the efficacy of drugs targeting human CD28
At present, human-derived tumor xenograft mouse models are widely used to study the efficacy of targeted drugs, but the targeting and specificity of this type of model in specific target research are not strong, so the results of this type of model for drug efficacy research are accurate Sex is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of humanized CD28 gene remolding animal model
  • Preparation method and application of humanized CD28 gene remolding animal model
  • Preparation method and application of humanized CD28 gene remolding animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0189] Example 1 Design of Cd28 gene sgRNA

[0190] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0191] Design and synthesize sgRNA sequences that recognize the 5' target site (sgRNA1-sgRNA12) and the 3' target site (sgRNA13-sgRNA20). The 5' target site is located on exon 2 of the Cd28 gene, and the 3' target site is located on exon 3 of the Cd28 gene. The target site sequences of each sgRNA sequence on Cd28 are as follows:

[0192] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-ctcggcattcgagcgaaactggg-3'

[0193] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-tgccgagttcaactgcgacgggg-3'

[0194] sgRNA-3 target site sequence (SEQ ID NO: 3): 5'-cgctgttcacgcccttgtacagg-3'

[0195] sgRNA-4 target site sequence (SEQ ID NO: 4): 5'-caagggcgtgaacagcgacgtgg-...

Embodiment 2

[0212] Example 2 Screening of Cd28 gene sgRNA

[0213] UCA kit was used to detect the activities of multiple sgRNAs. The results showed that the sgRNAs had different activities. For the test results, see figure 1 and Table 1. According to the results of activity detection, sgRNA4 and sgRNA17 were selected for subsequent experiments. The upstream and downstream single-strand sequences of sgRNA4 and sgRNA17 are as follows:

[0214] sgRNA4 sequence:

[0215] Upstream: 5'-GCGTGAACAGCGACG-3' (SEQ ID NO: 21)

[0216] Downstream: 5'-CGTCGCTGTTCACGC-3' (SEQ ID NO: 22)

[0217] sgRNA17 sequence:

[0218] Upstream: 5'-TCATCTCCTAAGCTGTTT-3' (SEQ ID NO: 23)

[0219] Downstream: 5'-AAACAGCTTAGGAGATGA -3' (SEQ ID NO: 24)

[0220] Table 1 sgRNA activity detection results

[0221]

[0222]

Embodiment 3

[0223] Example 3 pT7-sgRNA G2 plasmid construction

[0224] The fragmented DNA containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector pHSG299 by restriction enzyme digestion (EcoRI and BamHI) in sequence. After sequencing verification by a professional sequencing company, the results showed that the target plasmid: pT7-sgRNAG2 plasmid was obtained , see the pT7-sgRNA G2 plasmid map figure 2 .

[0225] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 25):

[0226]gaattctaatacgactcactataggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of a humanized CD28 gene remolding animal model. The invention also provides a sgRNA sequence capable of specifically targeting the Cd28 gene, a method for preparing a multi-gene humanized animal model and related applications. According to the invention, a tool mouse suitable for transplantation of a humanized cell or tissue and a preparation method of a novel humanized animal model are provided, a research of related diseases is facilitated and an effective technical means is provided for the development of biomedical experiments.The invention also relates to remolding an non-human animal by using a humanized gene, in particular to remolding a rodent by using the gene. Particularly, remolding a mouse by using the gene relatesto the preparation method of the humanized CD28 gene remolding animal model and the application thereof in the field of biomedicine.

Description

technical field [0001] This application relates to the establishment method and application of a humanized genetically modified animal model, in particular, it relates to a construction method based on a humanized CD28 genetically modified animal model and its application in biomedicine. Background technique [0002] Experimental animal disease models are indispensable research tools for the study of the etiology and pathogenesis of human diseases, the development of prevention technologies and the development of drugs. However, due to the differences in the physiological structure and metabolic system between animals and humans, traditional animal models cannot well reflect the real conditions of the human body. It is an urgent need for the biomedical industry to establish disease models in animals that are closer to the physiological characteristics of humans . [0003] With the continuous development and maturity of genetic engineering technology, it has been realized to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/113C12N15/90C12N5/10C12N15/62C12N15/12C07K19/00A01K67/027
CPCA01K67/0276A01K67/0278C12N15/113C12N15/8509C12N15/907C07K14/70521A01K2207/15A01K2227/105A01K2217/072A01K2217/075A01K2267/03C12N2310/20C07K2319/00C12N2310/10A01K2267/0331C12N2015/8572A61K49/0008C07K2319/03
Inventor 沈月雷白阳郭雅南张美玲黄蕤尚诚彰姚佳维
Owner BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com