Method for screening stem cell homing promotion drugs, recombinant vector and cell strain
A recombinant vector, cell line technology, applied in epidermal cells/skin cells, biochemical equipment and methods, animal cells, etc., can solve the problems of limited treatment effect, low cardiac retention rate, etc., and achieve the effect of broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Construction of pGL4.17-CXCR4 Recombinant Vector and Identification of Double Enzyme Digestion
[0030] Check the CXCR4 promoter sequence as follows, and obtain the CXCR4 promoter sequence artificially:
[0031] CXCR4-F:5’-CTCGAGTACCGACCACCCGCAAACAGCAGGGTCCCCTGGGCTTCCCAAGCCGCGCACCTCTCCGCCCCGCCCCTGCGCCCTCCTTCCTCGCGTCTGCCCCTCTCCCCCACCCCGCCTTCTCCCTCCCCGCCCCAGCGGCGCATGCGCCGCGCTCGGAGCGTGTTTTTATAAAAGTCCGGCCGCGGCCAGAAACTTCAGTTTGTTGGCTGCGGCAGCAGGTAGCAAAGTGACGCCGAGGGCCTGAGTGCTCCAGTAGCCACCGCATCTGGAGAACCAGCGGTTACCAAGCTT-3’
[0032]CXCR4-R:5’-AAGCTTGGTAACCGCTGGTTCTCCAGATGCGGTGGCTACTGGAGCACTCAGGCCCTCGGCGTCACTTTGCTACCTGCTGCCGCAGCCAACAAACTGAAGTTTCTGGCCGCGGCCGGACTTTTATAAAAACACGCTCCGAGCGCGGCGCATGCGCCGCTGGGGCGGGGAGGGAGAAGGCGGGGTGGGGGAGAGGGGCAGACGCGAGGAAGGAGGGCGCAGGGGCGGGGCGGAGAGGTGCGCGGCTTGGGAAGCCCAGGGGACCCTGCTGTTTGCGGGTGGTCGGTACTCGAG-3’
[0033] Restriction sites XhoI and HindIII were introduced into the 5' end and 3' end of the CXCR4 promoter sequence for whole gene synthesis...
Embodiment 2
[0035] Example 2 Establishment of Stably Transduced Monoclonal Cell 293-CXCR4
[0036] Human embryonic kidney epithelial cells 293 were planted in a 6-well plate, and when they reached 90% confluence, they were co-transfected with pGL4.17-CXCR4 obtained in Example 1 and Renilla fluorescent plasmid pRL-TK as an internal reference, and the medium was changed after 24 hours Add G418 at a final concentration of 1 mg / ml to continue the culture. 10 days after adding G418, trypsinize the adherent cells, collect and pipette into a single cell suspension, and then plant them in a 96-well plate at a density of 1 cell / well. The monoclonal cells were picked and inoculated in a 96-well plate at the same density for expanded culture. After 24 hours, D-luciferin with a final concentration of 60 μg / mL was added, and the in vivo fluorescence imaging system was taken. The results of the fluorescence intensity were as follows: image 3 Shown; the clone with the strongest signal (the third) was s...
Embodiment 3
[0038] Example 3 Screening of Candidate Monomers for Promoting Stem Cell Homing
[0039] Spread the 293-CXCR4P monoclonal cells on a 96-well plate at a density of 1000 cells / well, and culture them without serum after the cells reach a confluence of about 90%, add candidate Chinese medicine monomers (8 μg / ml), and use ginsenoside Rb1 as a positive control , no drug was added as a negative control.
[0040] After acting for 24 hours, the luciferase activity value was detected by a dual-luciferase reporter gene detection system, and the expression level of the CXCR4 promoter was reflected by the relative value of luc2 luciferase activity.
[0041] The steps are as follows: after lysing the cells, firefly luciferase detection reagent II (LARII) was added to detect luc2 fluorescence signal, and then Stop&GloR reagent was added to detect the fluorescence intensity of Renilla. The relative fluorescence activity of luc2 in the positive control group and the candidate drug group = thi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


