Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for screening stem cell homing promotion drugs, recombinant vector and cell strain

A recombinant vector, cell line technology, applied in epidermal cells/skin cells, biochemical equipment and methods, animal cells, etc., can solve the problems of limited treatment effect, low cardiac retention rate, etc., and achieve the effect of broad application prospects.

Inactive Publication Date: 2019-01-04
SHANGHAI UNIV OF T C M
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the low cardiac survival rate of MSCs after transplantation severely limits their therapeutic efficacy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening stem cell homing promotion drugs, recombinant vector and cell strain
  • Method for screening stem cell homing promotion drugs, recombinant vector and cell strain
  • Method for screening stem cell homing promotion drugs, recombinant vector and cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Construction of pGL4.17-CXCR4 Recombinant Vector and Identification of Double Enzyme Digestion

[0030] Check the CXCR4 promoter sequence as follows, and obtain the CXCR4 promoter sequence artificially:

[0031] CXCR4-F:5’-CTCGAGTACCGACCACCCGCAAACAGCAGGGTCCCCTGGGCTTCCCAAGCCGCGCACCTCTCCGCCCCGCCCCTGCGCCCTCCTTCCTCGCGTCTGCCCCTCTCCCCCACCCCGCCTTCTCCCTCCCCGCCCCAGCGGCGCATGCGCCGCGCTCGGAGCGTGTTTTTATAAAAGTCCGGCCGCGGCCAGAAACTTCAGTTTGTTGGCTGCGGCAGCAGGTAGCAAAGTGACGCCGAGGGCCTGAGTGCTCCAGTAGCCACCGCATCTGGAGAACCAGCGGTTACCAAGCTT-3’

[0032]CXCR4-R:5’-AAGCTTGGTAACCGCTGGTTCTCCAGATGCGGTGGCTACTGGAGCACTCAGGCCCTCGGCGTCACTTTGCTACCTGCTGCCGCAGCCAACAAACTGAAGTTTCTGGCCGCGGCCGGACTTTTATAAAAACACGCTCCGAGCGCGGCGCATGCGCCGCTGGGGCGGGGAGGGAGAAGGCGGGGTGGGGGAGAGGGGCAGACGCGAGGAAGGAGGGCGCAGGGGCGGGGCGGAGAGGTGCGCGGCTTGGGAAGCCCAGGGGACCCTGCTGTTTGCGGGTGGTCGGTACTCGAG-3’

[0033] Restriction sites XhoI and HindIII were introduced into the 5' end and 3' end of the CXCR4 promoter sequence for whole gene synthesis...

Embodiment 2

[0035] Example 2 Establishment of Stably Transduced Monoclonal Cell 293-CXCR4

[0036] Human embryonic kidney epithelial cells 293 were planted in a 6-well plate, and when they reached 90% confluence, they were co-transfected with pGL4.17-CXCR4 obtained in Example 1 and Renilla fluorescent plasmid pRL-TK as an internal reference, and the medium was changed after 24 hours Add G418 at a final concentration of 1 mg / ml to continue the culture. 10 days after adding G418, trypsinize the adherent cells, collect and pipette into a single cell suspension, and then plant them in a 96-well plate at a density of 1 cell / well. The monoclonal cells were picked and inoculated in a 96-well plate at the same density for expanded culture. After 24 hours, D-luciferin with a final concentration of 60 μg / mL was added, and the in vivo fluorescence imaging system was taken. The results of the fluorescence intensity were as follows: image 3 Shown; the clone with the strongest signal (the third) was s...

Embodiment 3

[0038] Example 3 Screening of Candidate Monomers for Promoting Stem Cell Homing

[0039] Spread the 293-CXCR4P monoclonal cells on a 96-well plate at a density of 1000 cells / well, and culture them without serum after the cells reach a confluence of about 90%, add candidate Chinese medicine monomers (8 μg / ml), and use ginsenoside Rb1 as a positive control , no drug was added as a negative control.

[0040] After acting for 24 hours, the luciferase activity value was detected by a dual-luciferase reporter gene detection system, and the expression level of the CXCR4 promoter was reflected by the relative value of luc2 luciferase activity.

[0041] The steps are as follows: after lysing the cells, firefly luciferase detection reagent II (LARII) was added to detect luc2 fluorescence signal, and then Stop&GloR reagent was added to detect the fluorescence intensity of Renilla. The relative fluorescence activity of luc2 in the positive control group and the candidate drug group = thi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a recombinant vector and a stable cell strain containing the recombinant vector. The recombinant vector and the stable cell strain containing the recombinant vector can be used for screening stem cell homing promotion drugs. The recombinant vector contains a CXCR4 promoter sequence and a luc2 luciferase report gene; and theluc2 luciferase report gene is positioned at the downstream of the CXCR4 promoter sequence. The stable cell strain which contains the recombinant vector and an internal reference luciferase vector canbe used for detecting the expression activity level of the CXCR4 gene, and then are used for screening the stem cell homing promotion drugs at high throughput. Therefore, the stable cell strain is added in a candidate drug for stimulation, through luc2 relative fluorescence intensity, the activity of promotion of the candidate drug on expression of the CXCR4 promoter can be evaluated, therefore,the stem cell homing drugs or drugs for treating myocardial infarction or assisting in treatment of the myocardial infarction are screened, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for constructing a dual-luciferase reporter cell line capable of stably expressing the CXCR4 promoter gene and its application. More specifically, the invention provides a drug that can be used for screening stem cell homing The construction method of the stably transformed cell line, and use it to screen possible drug monomers, provides biological materials for high-throughput screening of drugs that promote stem cell homing. Background technique [0002] Progressive heart failure caused by myocardial infarction (MI) is still a great challenge of modern heart disease. Transplantation of autologous or allogeneic mesenchymal stem cells (mesenchymal stem cells, MSCs) can enhance cardiac function, reduce infarct size, and delay the progression of heart failure. It has broad application prospects in the treatment of MI. However, the low cardiac survival rate of MSCs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N5/10C12N15/66C12Q1/02
CPCC12N5/0625C12N5/0686C12N15/66C12N15/85C12N2510/02G01N33/5008G01N2800/324
Inventor 王莹赵亮徐冉驰王强利王亚辉李英国海东蔡昊付云飞吴心语
Owner SHANGHAI UNIV OF T C M
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More