Unlock instant, AI-driven research and patent intelligence for your innovation.

Laodelphax striatellus lethal gene fragment ATPase and application thereof

A technology of gene fragments and striatellus, applied in the field of agricultural biology, can solve the problems of environmental pollution and poor control effects of chemicals, and achieve the effects of low synthesis cost, significant lethal effect, and easy large-scale application

Active Publication Date: 2019-01-18
CHANGSHA AGREEN BIO TECH LTD CO
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laodelphax striatellus lethal gene fragment ATPase and application thereof
  • Laodelphax striatellus lethal gene fragment ATPase and application thereof
  • Laodelphax striatellus lethal gene fragment ATPase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Cloning method of ATPase gene fragment:

[0038] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0039] (2) Synthesizing the first strand of cDNA;

[0040] (3) Obtain the gene fragment sequence from the SBPH transcriptome, in http: / / www.ncbi.nlm.nih.gov / After the homology comparison, it was predicted to be the ATPase gene of S. striatellus, and P1 and P2 were designed using Primer premier 5.0 software, and amplified by RT-PCR method;

[0041] Upstream primer (P1): 5'GCCGGCGTCGCCCACACT 3'(SEQ ID NO.2),

[0042] Downstream primer (P 2): 5'ATTCTCAACACCGTACAG 3' (SEQ ID NO.3);

[0043] The PCR conditions are: 94°C denaturation for 2min, 94°C for 30sec, 55°C for 30sec, 72°C for 30sec, 35 cycles, 72°C extension PCR reaction system (50μL):

[0044]

[0045] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0046] (5) Insert the recovered target fragment into the pEASY-T3 vecto...

Embodiment 2

[0050] Embodiment 2.dsRNA synthesis and recovery

[0051](1) Design P3 and P4 using Primer Premier 5.0 software based on the verified ATPase gene fragment sequence;

[0052] Upstream primer (P3): 5'TAATACGACTCACTATAGGGGTCTTACCGCAACCAG 3'(SEQ ID NO.5)

[0053] Downstream primer (P4): 5'TAATACGACTCACTATAGGGCATTCCCGATGCCACT 3'(SEQ ID NO.6)

[0054]

[0055]

[0056] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0057] (2) The PCR product was separated by electrophoresis on a 1% low-melting point agarose gel and observed under ultraviolet light. The sequence is shown in SEQ ID NO.4.

[0058] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0059] ① Cut the gel of the separated target fragment, put it into a 1.5ml microcentrifuge tube that has been weighed in (a), weigh (b) again, and calculate the weight of the cut gel in b-a;

[0060] ② According to the gel weight, add ...

Embodiment 3

[0069] Example 3 Planthopper feeding dsRNA experiment

[0070] (1) Seal one end of the glass tube with a parafilm, absorb second-instar planthoppers (BPH, BPH) into different glass tubes with an insect sucker, and seal the other end with gauze;

[0071] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, and put the prepared parafilm sticker face up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0072] (3) Use a pipette gun to draw 100 μl of feed and drop it in the center of the parafilm. The control group only adds feed (see Table 2 for formula), and the treatment group adds dsRNA of ATPase gene in the feed. The dsRNA concentration is 3300ng / μl. Parafilm, with the side of the sticker facing down, stick on the glass tube nozzle, and seal the feed and dsRNA between the two layers of parafilm;

[0073] (4) Put the glass tube w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a laodelphax striatellus lethal gene fragment ATPase and application thereof. The invention screens out the lethal gene fragment ATPase of the grey planthopper which can causethe death of the grey planthopper after interference as shown in SEQ ID NO. 1, The dsRNA of the gene fragment is used for feeding the grey planthopper and the brown planthopper, which can effectivelykill the grey planthopper and the brown planthopper. The invention is safe for the environment, ecology and food, and provides a new way for establishing the RNA interference technology for controlling pests.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to ATPase, a lethal gene fragment of striatellus striatellus, and an application thereof. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a gene silencing ph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/14C12N15/55C12N15/10A01N37/46A01P7/04
CPCA01N37/46C12N9/14
Inventor 王亚琴王书平李飞贺康肖花美胡涛
Owner CHANGSHA AGREEN BIO TECH LTD CO