Chickenpox-zoster virus glycoprotein E gene expression vector, recombinant yeast strain thereof and application thereof

A herpes zoster virus, gene expression technology, applied in the field of genetic engineering, to achieve the effect of high-efficiency expression

Pending Publication Date: 2019-01-18
BRAVOVAX
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the characteristics of the glycoprotein E gene of varicella-zoster virus and the insufficiency of other expression systems, expressing the glycoprotein E gene of varicella-zoster virus with Pichia pastoris ex...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chickenpox-zoster virus glycoprotein E gene expression vector, recombinant yeast strain thereof and application thereof
  • Chickenpox-zoster virus glycoprotein E gene expression vector, recombinant yeast strain thereof and application thereof
  • Chickenpox-zoster virus glycoprotein E gene expression vector, recombinant yeast strain thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Preparation and construction method of embodiment 1 recombinant vector

[0061] 1. Synthesis of VZV gE gene sequence

[0062] According to the yeast codon preference, the original sequence of gE was codon-optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.

[0063] SEQ ID NO.1:

[0064] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCC...

Embodiment 2

[0073] Example 2 Preparation of recombinant yeast strain and its expression detection

[0074] 1. Transformation of recombinant plasmid pGAPZαA-gE yeast strain

[0075] The recombinant plasmid pGAPZαA-gE obtained in Example 1 was transformed into Escherichia coli DH5α, a single colony was picked for shaking flask culture, and a large number of plasmids were extracted, and the single colony prevailed. The extracted recombinant plasmid pGAPZαA-gE was linearized and single-digested with the restriction endonuclease Avr II. After the linearization of the restriction endonuclease was detected by agarose gel electrophoresis, the digested vector was gel-recovered.

[0076] Fresh X33 yeast competent cells were prepared, and the linearized vector was electrotransformed into X33 yeast competent cells. At the same time, the linearized pGAPZαA empty vector was transformed as a control. The electroporation conditions were: 2000V, 25μF, 400Ω, electroporation for 5ms. After electric shock, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a chickenpox-zoster virus glycoprotein E gene expression vector, a recombinant yeast strain thereof and the application thereof. The vector is chickenpox as shown in SEQ ID NO:1. The complete gene sequence of herpes zoster virus glycoprotein E and the linker of pGAPZ alpha A. The expression system of the Pichia pastoris disclosed by the invention can successfully express chickenpox. The glycoprotein E of herpes zoster virus lays a foundation for the following immunogenicity detection and high expression in Pichia pastoris as well as the development of varicella zostervaccine.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an expression vector capable of expressing varicella-zoster virus glycoprotein E gene, its recombinant yeast and its application. Background technique [0002] Varicella-zoster virus (VZV) is a member of the α-herpesvirus subfamily of the genus Herpesviridae. It is a DNA virus with a diameter of 150-200 nm. Morphologically, it is composed of a nucleic acid core and a protein capsid. A concentric circular structure composed of an envelope, and a symmetrical icosahedron composed of 162 shell particles on the surface. It has the characteristics of tropism for the skin and nerves. It is a double-stranded DNA virus that frequently occurs in young children and the elderly. It is a A fast-onset, highly contagious disease. It can cause chickenpox and herpes zoster, two common diseases, and can also cause serious complications such as encephalitis and pneumonia; after the patient recov...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/81C12N15/66C12N15/38C12N1/19C12R1/84
CPCC07K14/005C12N15/66C12N15/815C12N2710/16722
Inventor 肖杨王雨高媛刘昊智毛普加袁军李津吴克
Owner BRAVOVAX
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap