Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

76 results about "Pichia philogaea" patented technology

PICHIA PHILOGAEA SP.NOV. 175 I0 lain [ S B ~!o~, Fig. 1. Pichiaphilogaea (CBS 6696). A. Vegetative cells in malt extract after 3 days at 28 C. B. Pseudomycelium on corn meal agar after 7 days at 28 C.

Human papilloma virus genes, vector, strain, and expression method thereof

The present invention relates to genes of the Pichia pastoris expression codon-optimized main capsid protein L1 of human papilloma virus types 52,31 and 45, a vector containing the genes, a strain, a preparation method, and an expression method thereof.
Owner:SHANGHAI ZERUN BIOTECHNOLOGY CO LTD

Optimized and improved phytase mutant and encoding gene and application thereof

The invention relates to the field of genetic engineering and particularly relates to an optimized and improved phytase mutant and an encoding gene and application thereof. According to the optimized and improved phytase mutant and the encoding gene and application thereof, one or more loca among the 10 locus, the 70 locus, the 142<nd> locus, the 159 locus and the 255 locus based on SEQ ID No. 2 phytase have amino acid replaced. A powerful genetic engineering means is utilized for improving phytase derivatives and pichia pastoris expression vectors, wherein the phytase derivatives and the pichia pastoris expression vectors serves as a source of escherichia coli, so that a pichia pastoris producing strain which is resistant to high temperature and high in enzyme activity of phytase is obtained. The improved phytase has more advantages in thermostabilization. Meanwhile, the output of the phytase produced through the bacterial strain is substantially raised, the fermenting enzyme activity of the phytase reaches 25400 U / mL within 180 hours and is raised by 59.8% compared with that of phytase which is not transformed. Therefore, the optimized and improved phytase can exhibit immense application potential in the feed industry.
Owner:GUANGDONG VTR BIO TECH

Construction and using method of pichia pastoris expression vector facilitating achievement of natural N end expression of protein

The invention relates to a construction and using method of a pichia pastoris expression vector facilitating achievement of natural N end expression of protein. The expression vector is formed by modifying a vector pPIC9K based on an isocaudarner principle only contains a single Xho I enzyme cutting site, and a pPIC9KM structure is shown in graph 1. After a target gene is connected to a Kex2 enzyme cutting site sequence in a pPIC9KM plasmid through a polymerase chain reaction (PCR) and a double-enzyme-cutting process, the target gene is secreted to the outside of a cell under the guidance of a secretion signal, signal peptide is processed and removed through Kex2 during the process, and the protein of the natural N end is achieved.
Owner:JIANGNAN UNIV

Method for expressing human lysozyme-antibacterial peptide Parasin I fusion protein by virtue of pichia pastoris

The invention discloses a human lysozyme-antibacterial peptide Parasin I fusion protein and also provides a genetic engineering preparation method of the human lysozyme-antibacterial peptide Parasin I fusion protein. The invention further provides an antibacterial recombinant protein having high activity which is prepared by carrying out enzyme digestion on the fusion protein to achieve a stronger bacteriostatic effect on microorganisms, linking the human lysozyme-antibacterial peptide Parasin I gene to an efficient gene eukaryotic expression vector in a form of fusion protein and in the manner of gene recombination and further expressing the human lysozyme-antibacterial peptide Parasin I gene in saccharomycetes. The recombinant protein can be applied in an animal feed as an additive.
Owner:SICHUAN AGRI UNIV

Pichia-pastoris engineering bacterium for producing glutathione

The invention discloses a pichia-pastoris engineering bacterium for producing glutathione and provides a method for constructing a recombinant bacterium. The method comprises the step of guiding the coding gene of bifunctional glutathione synthetase into an original strain to obtain the recombinant bacterium. Experiments show that the recombinant bacterium prepared by adopting the method can be used for producing the glutathione, ensures the high yield and lays a foundation for the industrial production and the preparation of the glutathione.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI

Specific activity and heat stability improved glucose oxidase mutant and encoding gene and application of glucose oxidase mutant

The invention discloses a specific activity and heat stability improved glucose oxidase mutant and an encoding gene and the application of the glucose oxidase mutant, and relates to the field of genetic engineering. The glucose oxidase (GOD) of Aspergillus niger GIM 3.452(CICC 2377) is genetically optimized according to the codon preference of pichia pastoris; the optimized gene is subjected to site-specific mutagenesis through the site-specific mutagenesis technology, and mutation sites comprise the second site, the tenth site, the twentieth site, the thirty fourth site, the seventieth site,the ninetieth site, the one hundred and sixth site, the one hundred and tenth site, the one hundred and sixty seventh site, the three hundreds and fifth site, and the five hundreds and ninth site. Theheat resistance property and the specific activity of the obtained mutant are higher than those of the original strain, the demands of application in the fields of foods, medicines, feeds, textile industries and the like are well met, and the mutant has a quite broad application prospect.
Owner:GUANGDONG VTR BIO TECH

High density fermentation method of glucose oxidase in pichia pastoris

The invention belongs to the technical field of microbial fermentation, and discloses a high density fermentation method of glucose oxidase in pichia pastoris. According to the high density fermentation method of glucose oxidase in pichia pastoris, a pichia pastoris genetically engineered bacterium strain with a preservation number of CGMCC No.11626 is taken as an original strain, a mixture of methanol and sorbitol at a volume ratio of 20:1 is adopted for induction of fermentation, GOD yield is increased further, and discharge enzyme activity is capable of reaching 905U / ml.
Owner:河北省微生物研究所有限公司

Thermostable chitosanase-producing engineered yeast strain and production method of thermostable chitosanase

The invention provides a recombinant thermostable chitosanase-producing engineered Pichia pastoris GS115 / HBCSN and a production method of thermostable chitosanase. The invention optimizes Aspergillus fumigatus chitosanase gene (GenBank accession number AY190324) based on the codon bias of Pichia pastoris, and the optimized nucleic acid sequence shows a 70% homology to the original nucleic acid sequence. The chitosanase produced by the recombinant Pichia pastoris can be secreted out of cells in a soluble form, with expression level of 3 mg / mL, and enzyme activity of 25,000U / mL. The chitosanase after glycosylation modification in Pichia pastoris has excellent thermal stability, which is proven by that the residual activities after treating at 80DEG C for 20 min, treating at 90DEG C for 40 min and treating at 100DEG C for 20 min are 56%, 87% and 87% respectively. The inventive thermostable chitosanase is especially suitable for large-scale industrial degradation of chitosan and environmental pollution reduction.
Owner:HUBEI UNIV

Recombinant saccharomyces cerevisiae engineering strain and application thereof

InactiveCN102220254AAbility to produce alcoholSimple processFungiBiofuelsBiotechnologyHigh activity
The invention discloses a recombinant saccharomyces cerevisiae engineering strain and application thereof. GAP gene fragments are cloned from Pichiapastoris GS115, and induced promoters of a PYES2 carrier are replaced by constitutive GAP promoters. Then an xylose reductase gene xyl1 fragment and an xylitol dehydrogenase gene xyl2 fragment are connected together and introduced into a PYES2 carrier containing constitutive GAP promoters to constitute a PYES2- GAP-xyl1-xyl2 plasmid. The plasmid is introduced into saccharomyces cerevisiae. The engineering strain of the present invention can co-express xylose reductase and xylitol dehydrogenase, has a high activity and high expression level of xylose reductase and xylitol dehydrogenase. In addition, the invention can efficiently utilize pentose and hexose degraded from cellulose and hemicellulose in straws, so as to increase output of fuel ethanol, reduce production costs and reduce environmental pollution. Therefore, the engineering strain can be used for producing fuel ethanol.
Owner:新疆农业科学院生物质能源研究所

Application of Pichia membranaefaciens strain to elimination of patulin

The invention discloses application of a yeast strain to elimination of patulin. The invention provides application of Pichia membranaefaciens to elimination of patulin. Experiments prove that Pichia membranaefaciens can quickly remove high concentration patulin in culture solution; patulin residues can not be detected four days after the Pichia membranaefaciens cells with concentration being 2*105cfu / ml are inoculated into the culture solution containing 100mu g / ml of patulin to be cultured; and patulin residues can not be detected six days after the Pichia membranaefaciens cells with concentration being 2*105cfu / ml are inoculated into the culture solution containing 200mu g / ml of patulin to be cultured. Application provided by the invention can provide a new solution to removal of patulin residues in such food as fruit juice.
Owner:INST OF BOTANY CHINESE ACAD OF SCI

Lipase mutant of marine streptomyces and application of lipase mutant

ActiveCN110540980AEfficient Catalytic SynthesisFungiHydrolasesStructure analysisStreptomyces
The invention discloses a lipase mutant of marine streptomyces and application of the lipase mutant, and belongs to the technical field of genetic engineering and enzyme engineering. According to thepresent invention, an enzyme mutation library is designed and constructed based on the structure analysis of an enzyme protein, the lipase mutant preferring to a substrate of partial glycerides is screened and obtained, and a Pichia engineering strain that efficiently expressed the mutant is constructed and obtained, so that a foundation for the wide application of the mutant is laid. Compared with the wild-type lipase, the lipase mutant of marine streptomyces provided by the invention is more efficient in catalyzing the synthesis of partial glycerides rich in n-3 fatty acids. Under the optimal reaction conditions, the content of partial glycerides in the catalytic product is 86.48% (49.01% of PUFA-DAG, and 37.47% of PUFA-MAG), and is increased to about 23 times compared with the wild-typelipase (3.8% of PUFA-DAG).
Owner:SOUTH CHINA UNIV OF TECH

Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase

The invention discloses a double-promoter multi-copy recombinant pichia pastoris engineering strain for highly producing endo-inulinase INU2. The strain is named pichia pastoris GS115-A3-G2, and is preserved in the general microbiology center of the China Committee for Culture Collection of Microorganisms on April 16th, 2014, and the preservation number is CGMCC NO:9049. According to the strain disclosed by the invention, the endo-inulinase gene INU2 multi-copy is integrated into pichia pastoris GS115 genome by two plasmids pPIC9K and pGAPZaA, and the double-promoter multi-copy recombinant pichia pastoris engineering strain for efficiently expressing the endo-inulinase is obtained in a screening manner. The experiment proves that the inulinase enzyme activity can be up to 3006U / ml in 3L high-density fermentation, simply purified crude enzyme can be directly applied to hydrolysis of inulin, so as to generate fructo-oligose, the conversion efficiency is high, production of the fructo-oligose by using inulin enzymatic hydrolysis in industry is achieved, and the double-promoter multi-copy recombinant pichia pastoris engineering strain has great practical value.
Owner:SHANDONG UNIV

Method for producing type 2 capsid protein grain vaccine of porcine circovirus by pichia pastoris expression system

The invention provides a method for producing type 2 capsid protein grain vaccine of porcine circovirus by a pichia pastoris expression system. The method comprises the following steps of: based on a PCV2-TJ strain gene sequence in GenBank as a template, obtaining a mature coding sequence of PCV-2 capsid protein Cap by amplification by a normal PCR method; connecting the gene with a capsid protein secreting type expression carrier pP-secSUMO3 to construct a pP-secSUMO3-Cap recombinant plasmid and amplifying by a heat stock method to convert escherichia coli JMS115; purifying the positive recombinant plasmid and electrically converting pichia pastoris strain GS115 by an electric converter of BioRad company; sieving high copy strains according to concentration gradient of antibiotic ZeocinTm; and respectively extracting genomic DNAs of the high copy strains as the template to perform PCR reaction to identify positive clone. The piglet challenge test verifies that the grain vaccine has good immunoprotection effect.
Owner:BEIJING DAWEIJIA BIOTECH SHARE CO LTD

Recombinant plasmid efficiently expressing xylanase and construction method for recombination Pichia pastoris

The invention provides a recombinant plasmid efficiently expressing xylanase and a construction method for recombination Pichia pastoris. Based on the preference of Pichia pastoris codon, aspergillus niger xylanase gene XynB is optimized, linked to Pichia pastoris expression vector pPICZ alpha A and expressed in Pichia pastoris GS115. The enzyme activity of recombinase GS115 / pPICZ alpha A-XynBopt is improved by 1.8 times. Double-coppy GS115 / pPICZ alpha A-(XynBopt)2 of xylanase XynBopt gene is constructed by employing an in-vitro tandem way. The activity of double-copy xylanase is improved by 1.9 times than the activity of single-copy xylanase. After ten days of induction, the enzyme activity of the double-copy xylanase is 15158.23 + / - 45.11 U / mL. The enzyme activity of purified xylanase is 6853.00 + / - 20.08 U / mg.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Optimized extremely-thermostable xylanase XYNH coding gene and application thereof

The invention relates to the field of genetic engineering, in particular to an optimized extremely-thermostable xylanase XYNH coding gene and application thereof. The nucleotide sequence of the nucleotide sequence is shown as SEQ ID NO:1. By means of the optimized extremely-thermostable xylanase XYNH coding gene and application, the problem of expression efficiency reduction caused by the codon preference of extremely-thermostable xylanase genes coming from bacteria in an eukaryotic expression system is solved; and xylanase XYNH which is excellent in character and has not been used for pichia pastoris expressions in the global yet is provided.
Owner:WUHAN SUNHY BIOLOGICAL

Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain

The invention discloses a recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme. The bacterial strain is named as pichia pastoris GS115-1NU1-INU2, which has been collected in China General Microbiological Culture Collection Center on April 16, 2014, with the collection number of CGMCC No.9050. The bacterial strain disclosed by the invention is obtained by expressing plasmids pPIC9 and pPIC9K, integrating an inulin excision enzyme gene and an inulin incision enzyme gene on a pichia pastoris GS115 genome, and screening. The bacterial strain is induced by methanol to ferment, so that two inulin enzymes can be expressed at the same time; enzyme activity of the inulin enzyme prepared by fermentation can achieve 4211.8U / ml; moreover, reaction time for producing monosaccharide by hydrolyzing inulin is short, and conversation efficiency is high, so that production of high fructose syrup by an enzyme method has sufficient feasibility; a conventional production method of high fructose syrup is replaced, and therefore, the recombinant pichia pastoris bacterial strain has a huge application value.
Owner:SHANDONG UNIV

Pichia pastoris expressing recombinant Thanatin antibacterial peptide

The invention discloses a pichia pastoris expressing a recombinant Thanatin antibacterial peptide. The recombinant Thanatin antibacterial peptide comprises the amino acid sequence of GSKKPVPIIYCNRRTGKCQRM. The pichia pastoris is used for the secretory expression of Thanatin, large-scale expression of Thanatin is realized, and production cost is reduced. By the adoption of the pichia pastoris production strain, the highest expression level of Thanatin reaches 0.6 g / L, the highest level in public reports; besides, a Thanatin antibacterial peptide exists in a fermentation supernatant, there is noneed to break cells, and a Thanatin sample containing few impure proteins can be obtained simply through filtration to remove thalli, which facilitates subsequent separation and purification of Thanatin and reduces production cost. The prepared Thanatin sample has a significant bacteriostatic effect on escherichia coli and salmonella.
Owner:GUANGDONG HINAPHARM PHARMA CO LTD

Recombinant pichia pastoris and expression product and application thereof

The invention provides recombinant pichia pastoris and an expression product and application thereof. A clonal sweet potato chitinase gene IbChiA is utilized to be operably connected with an expression carrier to obtain a recombinant expression carrier capable of expressing the protein; the recombinant expression carrier is imported into right host cells to obtain a genetically engineered bacterium for expressing the IbChiA. The invention further provides a method for preparing the IbChiA. The method comprises the step that by culturing pPICZalpha and IbChiA-X33, the chitinase IbChiA is obtained through inducible expression, wherein according to the induction conditions, an inducer methyl alcohol is supplemented one time every 24 hours until the final concentration of the methyl alcohol is1.0%. The invention further provides the application of the sweet potato chitinase in hydrolyzing colloidal chitin and inhibiting plant pathogenic fungi. The sweet potato chitinase prepared in the method has high inhibiting effects on ophiostoma fimbriatum and root rot fungi; according the method for the recombinant pichia pastoris to express the sweet potato chitinase, the extracellular secretion volume can reach 403 mg/L, and with the colloidal chitin as a substrate, the enzyme activity reaches 20 U/ml.
Owner:XUZHOU NORMAL UNIVERSITY

Glucose oxidase gene Glox, protein, pichia pastoris and preparation and application of pichia pastoris

The invention belongs to preparation of new genes and establishment of engineering bacteria, and particularly relates to a glucose oxidase gene Glox and preparation, establishment and application of pichia pastoris. 5c / end ATGAAGCTCCTTGGCCTCC and 3c / end CTAATTAACAGTAGCGTTGTAATC serve as specific primers, penicillium expansum DNA serves as a template, the glucose oxidase Glox gene is obtained through a PCR amplification method, and the pichia pastoris engineering bacteria are successfully established. The problem that currently, a glucose oxidase gene is recombined for heterologous expressionis solved, the full-length gene Glox and a shuttle expression carrier established by the Glox gene are obtained, the gene Glox is further converted into a pichia pastoris X33 strain, and a strain better secretorily expressing glucose oxidase than an original strain is obtained through screening and identification. The method is simple and easy to carry out, the cost is low, and a good foundationis laid for large-scale production of glucose oxidase.
Owner:河北省微生物研究所有限公司 +1

Thermus thermophilus laccase (benzenediol: oxygen oxidoreductases), engineering bacteria, recombinant laccase and use of recombinant laccase

ActiveCN104004721AHas laccase activityGood heat and alkali resistanceFungiMicroorganism based processesPichia pastorisOxidoreductase
The invention discloses a thermus thermophilus laccase (benzenediol: oxygen oxidoreductases), engineering bacteria, a recombinant laccase and a use of the recombinant laccase. The thermus thermophilus laccase has an amino acid sequence shown in the formula of Seq No.2. The DNA sequence for coding the above laccase is shown in the formula of Seq No.1. The DNA can be used in construction of a Pichia pastoris expression system. Through expression vector pHKFA1-lacTT linearization and then Pichia pastoris conversion by the expression vector, recombinant Pichia pastoris engineering bacteria are obtained. The recombinant laccase is obtained by fermentation of the recombinant Pichia pastoris engineering bacteria. The recombinant laccase has laccase activity and high temperature resistance, can be used in dye decoloring and especially in azo dye and anthraquinone dye decoloring, and has a decolourization ratio of 100%.
Owner:SOUTH CHINA UNIV OF TECH

Swine-derived antibacterial peptide cecropin P1 mutant as well as preparation method and application of swine-derived antibacterial peptide cecropin P1 mutant

The invention provides a swine-derived antibacterial peptide cecropin P1 mutant as well as a preparation method and application of the swine-derived antibacterial peptide cecropin P1 mutant. The preparation method comprises the steps of carrying out spatial structural analysis on an amino acid sequence of a swine-derived antibacterial peptide cecropin P1 through biological software; carrying out mutation (R10L, K12N) on 2 amino acids selected from 31 amino acids; and adding asparagine at the C tail end so as to be beneficial to the amidation of the C tail end to obtain a novel swine-derived antibacterial peptide mutant with a remarkably-improved antibacterial effect. On the basis, a pichia pastoris optimal codon is selected to artificially synthesize a novel swine-derived antibacterial peptide cecropin P1 mutant gene which is cloned into pichia pastoris to express to obtain a novel antibacterial peptide recombinant yeast strain, and the fermentation scale is amplified to the level of a fermentation tank, so that the high-density fermentation and efficient expression of an antibacterial peptide product are realized. After being further purified, a fermentation solution can be prepared into powder, liquid and other antibacterial peptide preparations for preventing and treating livestock and poultry diseases.
Owner:ANHUI HAOXIANG AGRI & ANIMAL HUSBANDRY +3

Method for constructing exoglucanase Cel6A and Cel7A in heterologous expression in pichia pastoris

The invention aims to construct recombinant pichia pastoris with heterologous expression of exoglucanase Cel6A and Cel7A. A method includes steps: (1) trichoderma reesei RNA and CDNA acquisition, to be more specific, adopting a solid induction medium for acquiring mycelia, and adopting a kit for extracting total RNA and cDNA; (2) target gene cloning, to be more specific, adopting a reasonable primer for PCR amplification to obtain a target gene; (3) expression vector construction, to be more specific, taking Ppic9k as a carrier, inserting the target gene into a downstream position of a promoter AOX1, wherein 5' and 3' terminated enzyme cutting sites are EcoRI and NotI respectively; (4) recombinant strain acquisition, to be more specific, taking SalI as a linearization site to realize expression vector linearization, and electrically converting to obtain recombinant yeast; (5) induced enzyme production of a recombinant strain, namely shaking for fermentation, and adopting appropriate methanol for inducing enzyme production; (6) recombinant protein activity detection, namely detecting recombinant protein expression quantity and activity through SDS-PAGE and Congo red-CMC. The recombinant strain constructed by the method is capable of efficiently expressing proteins with his tags, and an efficient single enzyme component can be obtained.
Owner:TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY

Recombined yeast strain expressing cellulase and applications thereof

The invention belongs to the technical field of genetic engineering and in particular to a recombined yeast strain expressing cellulase and applications thereof in producing the cellulose; a multi-copy cellulose gene is integrated into a secretory expression vector; an apoenzyme secretion expression plasmid is constructed; and pichia yeast recipient bacterium is led to obtain the recombined pichia yeast expressing the cellulose. The recombined pichia yeast expressing the cellulose is high in yield and high in activity and can be used for extracellularly secreting the apoenzyme.
Owner:陈战

DNA molecule used for recombinant pichia plasmid and recombinant pichia strain expressing ppri protein of deinococcus radiodurans

ActiveUS20170016009A1Successfully and efficiently expressSuccessfully and efficiently express and purify PprIHydrolasesPeptide/protein ingredientsPlasmidVirology
A DNA molecule comprising the sequence set forth in SEQ ID NO: 1, a recombinant Pichia plasmid into which the DNA molecule is inserted, and a recombinant Pichia strain obtained by the transformation of the recombinant Pichia plasmid into a competent Pichia cell and efficiently expressing the PprI protein of Deinococcus radiodurans.
Owner:SUZHOU UNIV

Hdiv-SARP19-I1 gene and antibacterial application of recombination protein of Hdiv-SARP19-I1 gene

InactiveCN105755007ADefining anti-Klebsiella pneumoniae functionDefined activity against KlebsiellaAntibacterial agentsPeptide/protein ingredientsPichia pastorisK pneumoniae
The invention provides an Hdiv-SARP19-I1 gene and antibacterial application of recombination protein of the Hdiv-SARP19-I1 gene, and relates to genetic engineering. A nucleic acid sequence of a protein encoding region of the Hdiv-SARP19-I1 gene is as shown in a sequence table SEQ ID No.1, the nucleic acid sequence of a sequence of the Hdiv-SARP19-I1 gene is as shown in a sequence table SEQ ID No.2, and the amino acid sequence of the protein sequence of Hdiv-SARP19-I1 is as shown in a sequence table SEQ ID No.3. The amino acid sequence of recombination protein of the Hdiv-SARP19-I1 expressed by pichia pastoris is as shown in a sequence table SEQ ID No.4. The recombination protein of the Hdiv-SARP19-I1 gene can be applied for preparation of protein medicines of antagonism Klebsiella pneumoniae and bactericides of the antagonism Klebsiella pneumoniae.
Owner:XIAMEN UNIV

Recombinant pichia pastoris capable of expressing keratinase and application of recombinant pichia pastoris

The invention discloses recombinant pichia pastoris capable of expressing keratinase and application of the recombinant pichia pastoris and belongs to the field of gene engineering. The recombinant pichia pastoris expresses the keratinase by taking pichia pastoris SMD1168 as a host and pPIC9k as a vector. The recombinant pichia pastoris capable of expressing the keratinase has the advantages that the constructed recombinant pichia pastoris is a recombinant strain obtained by means of fermentation culture, and when fermentation culture reaches 168 hours, dry cell weight is up to 174.1g / L, and enzyme activity of extracellular keratinase is up to 1156U / mL, thus, the recombinant pichia pastoris is more suitable for industrial production of the keratinase.
Owner:JIANGNAN UNIV

Signal sequence for protein expression in pichia pastoris

The present invention relates to a signal sequence from a unique Pichia pastoris protein. Further the invention discloses use of signal sequence for the expression of heterologous protein in Pichia pastoris.
Owner:BIOCON LTD

Preparation and expression method of chicken beta-defensin 9 yeast engineered bacteria

The invention discloses preparation and an expression method of a chicken beta-defensin 9 yeast engineered bacteria, and belongs to the fields of biological technology and gene engineering pharmaceutical technology. The preparation process comprises: utilizing a pichia yeast consistently-used codon to optimize chicken beta-defensin 9 gene, adding a Kex2 restriction enzyme cutting site coding sequence at the front terminal of the gene, and artificially synthesizing the gene; then inserting the synthetic beta-defensin 9 gene sequence into a yeast constitutive expression vector, integrating into a the chromosome of a methylotrophy type pichia yeast by homologous recombination; and screening for multiple times to obtain the yeast engineered bacteria for producing chicken beta-defensin 9. The yeast engineered bacteria is capable of continuously performing high-level protein expression after fermentation and culturing, the expressed product is high in yield, is relatively close to the natural structure, is secreted in the broth, and also has relatively strong anti-foodborne pathogenic activity. The broth is subjected to preliminary separation and can be directly used as a forage additive after concentrated or dried, and the forage additive is applied to animal breeding industry, so that the production cost of defensin is reduced and the economic benefit of a production enterprise is improved. The technical scheme provided by the invention helps to establish a technological base for industrial large-scale production and application of beta-defensin 9 and development of poultry forage antibiotic additive substitutes.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Recombinant strain producing alkaline polygalacturonate lyase and application thereof

ActiveCN106520587AAchieve efficient expressionFungiMicroorganism based processesBiotechnologyYeast
Belonging to the technical field of genetic engineering, the invention discloses a recombinant strain producing alkaline polygalacturonate lyase (PGL) and application thereof. By means of gene recombination technology, the ERO1 and UBC1 gene of pichia pastoris are combined, cloned and connected to a pichia pastoris expression vector pPGAZA, and are transformed into a GS115 / N185Q strain, thus obtaining a GS115 / N185Q-ERO1-UBC1 strain highly-expressing alkaline polygalacturonate lyase than the original strain, during shaking flask fermentation, compared with the strain GS115 / N185Q before use of the method, the enzyme activity is increased by 54.2%, and after fermentation culture in a 3L fermentation tank, the maximum enzyme activity can reach 5485.68U / mL, which is the maximum yield of PGL reported in the literature currently, and the recombinant strain realizes efficient expression of alkaline polygalacturonate lyase.
Owner:JIANGNAN UNIV

Expression and purification method of chicken growth hormone recombinant protein in Pichia pastoris

The invention discloses an expression and purification method of chicken growth hormone recombinant protein in Pichia pastoris. The expression and purification method includes the steps of firstly, extracting total RNA (ribonucleic acid) from chicken pituitary, performing reverse transcription PCR (polymerase chain reaction) to obtain cDNA (complementary deoxyribonucleic acid) and conducting PCR by taking the cDNA as a template so as to obtain chicken growth hormone gene fragments; secondly, using the Pichia pastoris for constructing a recombinant expression vector pPIC9K-cGH; thirdly, subjecting Pichia pastoris GS115 to electrotransformation by the recombinant expression vector pPIC9K-cGH and screening to obtain a transgenic recombinant yeast strain GS115-pPIC9K-cGH; fourthly, obtaining the chicken growth hormone recombinant protein through methanol induced expression and purification, and identifying activity of the chicken growth hormone recombinant protein through cell activity test. In the expression and purification method of the chicken growth hormone recombinant protein in the Pichia pastoris, high-efficiency expression of the cGH (chicken growth hormone) recombinant protein in the Pichia pastoris is achieved and a purification system is established firstly, so that the high-purity chicken growth hormone recombinant protein with activity can be obtained. The expression and purification method of the chicken growth hormone recombinant protein in the Pichia pastoris is simple and convenient to operate, high in yield and low in cost and provides a basis for further studies on structures, functions and production application of chicken growth hormone.
Owner:CHANGSHU INSTITUTE OF TECHNOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More