Human papilloma virus genes, vector, strain, and expression method thereof

A human papilloma virus and gene technology, which is applied in the field of molecular biology, can solve the problems of low expression level and no expression, and achieves the effects of high expression amount, simple operation, and large-scale industrial production.

Active Publication Date: 2015-04-15
SHANGHAI ZERUN BIOTECHNOLOGY CO LTD
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in expression systems such as Escherichia coli, Pichia pastoris, and baculovirus, L1 protein is often limited by the frequency of amino acid codon usage in these organisms, resulting in low or no expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human papilloma virus genes, vector, strain, and expression method thereof
  • Human papilloma virus genes, vector, strain, and expression method thereof
  • Human papilloma virus genes, vector, strain, and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: HPV52L1 codon optimization design

[0051] The 52L1 sequence was synthesized based on the wild-type HPV52L1 amino acid sequence (GenBank: CAA52590.1, SEQ ID NO: 1) and Pichia-preferred codons. The wild-type HPV52L1 DNA sequence was transformed, all codons were used in Pichia pastoris with higher or highest frequency of use, and the formation of secondary structure and the selection of enzyme cutting sites were considered to finally obtain the HPV52L1 gene of the present invention. Nucleotide sequence SEQ ID NO:2.

Embodiment 2

[0052] Embodiment 2: Construction of HPV52L1 recombinant expression vector

[0053] The synthesized 52L1 sequence was cloned into pPICZalphaB vector (Invitrogen) by the following method. The 52L1 DNA fragment with BstBI and KpnI at both ends was amplified by PCR, and PCR primers: forward primer: 5'CAGGTGATCTTCGAAACGATGAGTGTTTGGAGAC3'(BstBI) (SEQ ID NO: 7); reverse primer: 5'ATTGGTACCCTATTATCTTTTAACT3'( KpnI) (SEQ ID NO: 8). PCR program: cycle 30 times at 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute and 50 seconds, 72°C for 10 minutes, 10°C for 10 minutes, and the operation ends. The PCR product was identified by agarose gel electrophoresis and the band at 1500bp was recovered (Qiagen gel extraction kit). The recovered fragments were digested with pPICZalphaB with BstBI and KpnI (New England Biolab), identified by agarose gel electrophoresis, and about 1500bp and 3600bp fragments were recovered respectively. After recovery, 52L1 and pPICZal...

Embodiment 3

[0054] Example 3: Construction and expression of HPV52L1 recombinant expression strain

[0055] Linearize pPICZ52L1 with SacI. After the enzyme digestion reaction, remove the protein with phenol: chloroform, add 2.5 times the volume of absolute ethanol, and precipitate DNA with 1 / 10 volume of 3M NaAc (pH5.2). The resulting precipitate is washed with 75% ethanol and dried. ddH 2 O dissolved the precipitate, electroporated Pichia host bacteria (Invitrogen), spread it on a YPDS plate (containing 180 μg / mL Zeocin), and cultured at 30°C for 3 days to obtain hundreds of clones. Dozens of clones were picked and inoculated on YPD plates (containing 1500 μg / mL Zeocin), screened for high-copy plasmid strains, and cultured at 30°C for 2 days. Some clones grew faster, and several clones with the best growth conditions were picked and inoculated in 5mL YPD liquid medium. After 24 hours, the BMMY medium was replaced, and the bacteria were collected after 48 hours of induction with 0.5% met...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention relates to genes of the Pichia pastoris expression codon-optimized main capsid protein L1 of human papilloma virus types 52,31 and 45, a vector containing the genes, a strain, a preparation method, and an expression method thereof.

Description

technical field [0001] This field relates to the field of molecular biology, in particular, the present invention relates to the gene of HPV52, HPV31, HPV45 type human papillomavirus main capsid protein L1 which is suitable for expression in Pichia pastoris through codon optimization, and the gene containing the Gene carrier, bacterial strain and method for expressing the gene. Background technique [0002] Cervical cancer is the second most common gynecological malignancy after breast cancer. More than 500,000 women worldwide are diagnosed with cervical cancer every year, and 270,000 women die from the disease, with an age-standardized infection rate of 10.5%. As early as the early 1980s, Harald zur Hausen discovered that human papillomavirus (HPV) infection was related to the incidence of cervical cancer, and a large number of subsequent studies have also proved that HPV is closely related to cervical cancer and its precancerous lesions. So far, more than 100 HPV genotype...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/37C12N15/81C12N1/19C07K14/025A61K39/12A61P31/20A61P35/00A61P17/12C12R1/84
Inventor丛薇刘瑞峰许丹
OwnerSHANGHAI ZERUN BIOTECHNOLOGY CO LTD