Optimized and improved phytase mutant and encoding gene and application thereof

A mutated gene and phytase technology, applied in phytase mutants and their coding genes and application fields, can solve the problems of reduced digestion and utilization of mineral elements and other nutrients, poor thermal stability, specific activity and production efficiency decline, etc. question

Active Publication Date: 2016-01-06
GUANGDONG VTR BIO TECH
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Monogastric animals and aquatic animals lack phytase to decompose phytic acid, phosphorus in the form of phytic acid is difficult to be absorbed and utilized by animals, resulting in the following problems: First, the presence of phytic acid in feed has anti-nutritional effects Phytate phosphorus itself is difficult to be hydrolyzed and utilized by the digestive tract of pigs, poultry and aquatic animals; phytic acid will combine with various metal ions and proteins during the digestion process of the gastrointestinal tract of animals to form insoluble complexes, making some digestive enzymes The role of the feed is inhibited, so that the digestion and utilization of mineral elements and other nutrients in the feed are greatly reduced
The thermal stability of wild phytase APPA is poor, and most of the Escherichia coli phytase preparations commercially available on the market are optimized and improved. The decline in activity and production efficiency is also worrying, so how to express more efficient thermostable phytase in host bacteria is the focus of enterprises to improve product quality and reduce costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized and improved phytase mutant and encoding gene and application thereof
  • Optimized and improved phytase mutant and encoding gene and application thereof
  • Optimized and improved phytase mutant and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0114] Embodiment 1, synthesis and cloning of phytase gene

[0115] Taking the amino acid sequence of the phytase derivative PHd derived from Escherichia coli as a reference (shown in SEQ ID NO.2), the gene was artificially synthesized (the nucleic acid sequence is shown in SEQ ID NO.3).

[0116] According to gene 5 ' Design PCR primers containing NdeI endonuclease site at the end, 3 ' Design PCR primers containing EcoRI endonuclease sites at the end, and the primer sequences are as follows:

[0117] 5 ' End primer NdeI-PHd-F1: GGATTAC CATATG CAGAGTGAGCCTGAGTTG

[0118] 3 ' End primer EcoRI-PHd-R1: CGG AATTC TTACTACAAGGAACAAGCTGG

[0119] Using the synthetic gene PHd as a template, carry out PCR amplification with the above primers, cut the gel to recover the amplified fragments, digest with NdeI and EcoRI double enzymes, connect to the NdeI and EcoRI sites of the pET-22b(+) vector, and transform Top10 Escherichia coli, cultured on LB-Amp plates to obtain pET-22b-PHd...

Embodiment 2

[0120] Embodiment 2, gene site-directed saturation mutation

[0121] Determine the 9 sites to be mutated in Escherichia coli phytase derivative PHd, which are: S at the 10th position, G at the 70th position, E at the 91st position, D at the 142nd position, R at the 159th position, S at the 212th position, Y at the 255th position, Q at the 353rd position, and G at the 373rd position, designed 9 pairs of saturation mutation primers, and the mutation site of the target gene was unified as NNS, and 15 bases were selected on the left and right sides of NNS Constitute the forward primer; the reverse primer is completely complementary to the forward primer, where N represents four bases such as A, T, C, and G, and S represents two bases such as C and G.

[0122] Using the recombinant vector pET-22b-PHd as a template, adding the forward and reverse primers of the mutation site, and Q5 high-fidelity PCR enzyme for PCR amplification, the product was digested with DpnI and then transform...

Embodiment 3

[0163] Embodiment 3, the construction of phytase PHd Pichia pastoris expression vector

[0164] According to the phytase PHd gene, 5 ' Design PCR primers containing EcoRI endonuclease sites at the end, 3 ' Design PCR primers containing NotI endonuclease site at the end, the primer sequence is as follows:

[0165] 5 ' End primer EcoRI-PHd-F1: GTA GAATTC CAGAGTGAGCCTGAGTTG

[0166] 3 ' End primer NotI-PHd-R1: ATT GCGGCCGC TTACTACAAGGAACAAGCTGG

[0167] Using the synthetic gene PHd as a template, carry out PCR amplification with the above primers, double digest the amplified fragment with restriction endonucleases EcoRI and NotI, purify, connect to the EcoRI and NotI sites of the pPICZαA vector, and make phytic acid The enzyme PHd gene was inserted downstream of the signal peptide sequence of the above expression vector. The ligation product was transformed into Top10 Escherichia coli, cultured on LB-Zeo plates to obtain pPICZαA-PHd positive colonies, and pPICZαA-PHd po...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering and particularly relates to an optimized and improved phytase mutant and an encoding gene and application thereof. According to the optimized and improved phytase mutant and the encoding gene and application thereof, one or more loca among the 10 locus, the 70 locus, the 142<nd> locus, the 159 locus and the 255 locus based on SEQ ID No. 2 phytase have amino acid replaced. A powerful genetic engineering means is utilized for improving phytase derivatives and pichia pastoris expression vectors, wherein the phytase derivatives and the pichia pastoris expression vectors serves as a source of escherichia coli, so that a pichia pastoris producing strain which is resistant to high temperature and high in enzyme activity of phytase is obtained. The improved phytase has more advantages in thermostabilization. Meanwhile, the output of the phytase produced through the bacterial strain is substantially raised, the fermenting enzyme activity of the phytase reaches 25400 U / mL within 180 hours and is raised by 59.8% compared with that of phytase which is not transformed. Therefore, the optimized and improved phytase can exhibit immense application potential in the feed industry.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to optimized and improved phytase mutants, coding genes and applications thereof. Background technique [0002] Phytate, Phytic acid, IP6, also known as phytate, contains 6 phosphate groups and is rich in phosphorus. It is an important storage form of phosphorus in feed. Phytase (Phytase) can catalyze the hydrolysis of phytic acid and phytate into inositol and phosphoric acid (or phosphate). [0003] Monogastric animals and aquatic animals lack phytase to decompose phytic acid, phosphorus in the form of phytic acid is difficult to be absorbed and utilized by animals, resulting in the following problems: First, the presence of phytic acid in feed has anti-nutritional effects Phytate phosphorus itself is difficult to be hydrolyzed and utilized by the digestive tract of pigs, poultry and aquatic animals; phytic acid will combine with various metal ions and proteins during the digest...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/81C12N1/19A23K1/165
Inventor李阳源何小梅周银华钟开新黄江陈丽芝刘丹妮刘金山唐业
OwnerGUANGDONG VTR BIO TECH