Check patentability & draft patents in minutes with Patsnap Eureka AI!

Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase

A technology of endo-inulinase and dual promoters, which is applied in the fields of genetic engineering and fermentation engineering to achieve high conversion efficiency and great commercial application value

Inactive Publication Date: 2014-08-13
SHANDONG UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After searching, there are no reports of recombinant Pichia pastoris strains with high-level expression of a single enzyme component of endo-inulinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase
  • Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase
  • Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of AOX promoter endinulinase INU2 multi-copy recombinant Pichia pastoris

[0035] 1. Construction of recombinant plasmid pPIC9K-INU2

[0036] 1.1 Genome extraction

[0037] The genome of Aspergillus ficuum CGMCC3.4322 was extracted with the Biospin Fungus Genomic DNA Extraction Kit (Bioer Technology co., Ltd.). For the specific preparation method, refer to the operation manual of the kit.

[0038] 1.2 Cloning of gene INU2

[0039] Use the genome extracted in 1.1 as the template of the PCR reaction, and design a pair of primers according to the known endinulinase gene sequence on NCBI: INU2-EcoR I Upstream: ACGC GAATTCCAGTCTAATGATTACCGTCCTT (the underlined part is the restriction site of EcoR I), downstream of INU2-Not I: ATA GCGGCCGC TCATTCAAGTGAAACACTCC (the underlined part is the Not I restriction site), perform PCR reaction, and clone INU2. PCR amplification conditions: pre-denaturation at 94°C for 2min; 98°C for 10sec; annealing at 55°C...

Embodiment 2

[0095] The construction of embodiment 2 double-promoter multi-copy inulin endonuclease gene engineering bacteria

[0096] 1. Construction of multi-copy recombinant plasmid pGAPZαA-3INU2

[0097] First construct the expression cassette of INU2 in Pichia pastoris, and then construct 3 copies of the expression cassette of INU2 on the plasmid pGAPZαA, the construction scheme is as follows Figure 4 . The specific construction process is as follows:

[0098] (1) Construction of recombinant plasmid pGAPZαA-INU2, i.e. INU2 expression cassette

[0099] The construction method of pGAPZαA-INU2 is as follows: Figure 5 . specific method:

[0100] First, design and synthesize primers for amplifying the INU2 gene:

[0101]

[0102] The template was the recombinant plasmid pPIC9K-INU2 (constructed in Example 1), and the target gene INU2 with EcoR I and Xba I restriction sites was obtained by PCR amplification, purified and recovered.

[0103] The target gene INU2 and plasmid pGAP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a double-promoter multi-copy recombinant pichia pastoris engineering strain for highly producing endo-inulinase INU2. The strain is named pichia pastoris GS115-A3-G2, and is preserved in the general microbiology center of the China Committee for Culture Collection of Microorganisms on April 16th, 2014, and the preservation number is CGMCC NO:9049. According to the strain disclosed by the invention, the endo-inulinase gene INU2 multi-copy is integrated into pichia pastoris GS115 genome by two plasmids pPIC9K and pGAPZaA, and the double-promoter multi-copy recombinant pichia pastoris engineering strain for efficiently expressing the endo-inulinase is obtained in a screening manner. The experiment proves that the inulinase enzyme activity can be up to 3006U / ml in 3L high-density fermentation, simply purified crude enzyme can be directly applied to hydrolysis of inulin, so as to generate fructo-oligose, the conversion efficiency is high, production of the fructo-oligose by using inulin enzymatic hydrolysis in industry is achieved, and the double-promoter multi-copy recombinant pichia pastoris engineering strain has great practical value.

Description

technical field [0001] The invention belongs to the field of genetic engineering and fermentation engineering, and relates to a dual-promoter multi-copy recombinant Pichia pastoris strain expressing a single enzyme component of endo-inulinase at a high level, a construction method and application thereof. Background technique [0002] Inulin is a chain-like macromolecule composed of D-fructofuranose molecules connected by 2,1-glycosidic bonds of β powder, and often contains a glucose group at the end. Inulinase is a hydrolase that catalyzes the hydrolysis of β-2,1-fructofuranosidic bonds in inulin. According to its mode of action on the substrate, it can be divided into two categories: one is exoinulinase (exoinulinase), which can cut off a fructose unit from the inulin powder end one by one, and the product is fructose and a small amount of glucose; the other is exoinulinase. One is endoinulinase (endoinμlinase), which randomly cuts a certain β-2,1-glucosidic bond from ins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12P19/04C12R1/84
Inventor 林建强林胜强白杨林建群
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More