Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase
A technology of endo-inulinase and dual promoters, which is applied in the fields of genetic engineering and fermentation engineering to achieve high conversion efficiency and great commercial application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of AOX promoter endinulinase INU2 multi-copy recombinant Pichia pastoris
[0035] 1. Construction of recombinant plasmid pPIC9K-INU2
[0036] 1.1 Genome extraction
[0037] The genome of Aspergillus ficuum CGMCC3.4322 was extracted with the Biospin Fungus Genomic DNA Extraction Kit (Bioer Technology co., Ltd.). For the specific preparation method, refer to the operation manual of the kit.
[0038] 1.2 Cloning of gene INU2
[0039] Use the genome extracted in 1.1 as the template of the PCR reaction, and design a pair of primers according to the known endinulinase gene sequence on NCBI: INU2-EcoR I Upstream: ACGC GAATTCCAGTCTAATGATTACCGTCCTT (the underlined part is the restriction site of EcoR I), downstream of INU2-Not I: ATA GCGGCCGC TCATTCAAGTGAAACACTCC (the underlined part is the Not I restriction site), perform PCR reaction, and clone INU2. PCR amplification conditions: pre-denaturation at 94°C for 2min; 98°C for 10sec; annealing at 55°C...
Embodiment 2
[0095] The construction of embodiment 2 double-promoter multi-copy inulin endonuclease gene engineering bacteria
[0096] 1. Construction of multi-copy recombinant plasmid pGAPZαA-3INU2
[0097] First construct the expression cassette of INU2 in Pichia pastoris, and then construct 3 copies of the expression cassette of INU2 on the plasmid pGAPZαA, the construction scheme is as follows Figure 4 . The specific construction process is as follows:
[0098] (1) Construction of recombinant plasmid pGAPZαA-INU2, i.e. INU2 expression cassette
[0099] The construction method of pGAPZαA-INU2 is as follows: Figure 5 . specific method:
[0100] First, design and synthesize primers for amplifying the INU2 gene:
[0101]
[0102] The template was the recombinant plasmid pPIC9K-INU2 (constructed in Example 1), and the target gene INU2 with EcoR I and Xba I restriction sites was obtained by PCR amplification, purified and recovered.
[0103] The target gene INU2 and plasmid pGAP...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
