Tobacco protein kinase gene NtCIPK25-1 as well as cloning method and application thereof
A technology of protein kinase gene and cloning method, applied in the field of tobacco protein kinase gene NtCIPK25-1 and its cloning
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] tobacco protein kinase gene NtCIPK25-1 clone
[0077] A. According to Arabidopsis AtNTCIPK25 The protein sequence of the gene (AED93402.1) searched the NCBI database to obtain the homologous gene in tobacco NtCIPK25-1 Sequence, use this sequence to design gene cloning primers:
[0078] Forward primer: NtCIPK25-1F: 5'- ATGAAAGACCCAATGAATCAATCAAAC -3'
[0079] Reverse primer: NtCIPK25-1R: 5'-TTAGTCTCTGCCATCATTCTCACC -3'
[0080] B. extract tobacco root tissue RNA, and reverse transcribe to obtain the first-strand cDNA;
[0081] C. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtCIPK25-1F / NtCIPK25-1R, and the PCR product was separated by agarose gel electrophoresis and recovered and purified ( figure 1 );
[0082] D. Ligate the purified product with the carrier. The ligation system and process are as follows: 4 μL of the purified product, 1 μL of salt solution, 1 μL of PCR®-BluntⅡ-TOPO (Inv...
Embodiment 2
[0084] tobacco NtCIPK25-1 Gene tissue-specific expression analysis
[0085] A. Planting and cultivating tobacco Yunyan 87, Wang extracted RNA from roots, stems and leaves for a long time, and obtained the first-strand cDNA by reverse transcription.
[0086] B. According to NtCIPK25-1 Gene sequence design qRT-PCR primers
[0087] QF: 5'-TATATCAGCAATGTCTTCAGGA-3',
[0088] QR: 5'-GAATTCCTTAGCAGATTCAATCT-3'.
[0089]Tobacco Actin gene was used as an internal reference, Actin-F: CTGAGGTCCTTTTCCAACCA and Actin-RTACCCGGGAACATGGTAGAG. Fluorescent quantitative PCR was carried out using root, stem, and leaf cDNA as templates, and the reaction was carried out on RocheLightCycler 480 using LightCycler 480 SYBR Green I master. The 20 µL system contained 10 µL LightCycler 480 SYBR Green I master (2×), and 1 µL each of the forward and reverse primers. (10 µmol / L), 1 µL of cDNA (reverse transcription product diluted 4 times), 7 µL of sterilized distilled water. The reaction program was...
Embodiment 3
[0091] tobacco NtCIPK25-1 Gene-encoded protein conserved domain analysis
[0092] Multiple sequence alignment of NtCIPK25-1 protein and Arabidopsis AtNTCIPK25 protein ( image 3 ). NtCIPK25-1 has conserved domains of CIPK protein, such as transmembrane region serine / threonine protein kinase region S_TKc, C-terminal regulatory domain CIPK_c, and NtCIPK25-1 protein has high homology with Arabidopsis AtNTCIPK25 protein.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


