Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tobacco protein kinase gene NtCIPK25-1 as well as cloning method and application thereof

A technology of protein kinase gene and cloning method, applied in the field of tobacco protein kinase gene NtCIPK25-1 and its cloning

Inactive Publication Date: 2019-03-15
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report about the CIPKs protein gene in tobacco, and the cloned tobacco CIPK Genes, it is of great significance to understand the regulation of CIPKs on tobacco potassium content, and then to cultivate high-quality tobacco leaves

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco protein kinase gene NtCIPK25-1 as well as cloning method and application thereof
  • Tobacco protein kinase gene NtCIPK25-1 as well as cloning method and application thereof
  • Tobacco protein kinase gene NtCIPK25-1 as well as cloning method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] tobacco protein kinase gene NtCIPK25-1 clone

[0077] A. According to Arabidopsis AtNTCIPK25 The protein sequence of the gene (AED93402.1) searched the NCBI database to obtain the homologous gene in tobacco NtCIPK25-1 Sequence, use this sequence to design gene cloning primers:

[0078] Forward primer: NtCIPK25-1F: 5'- ATGAAAGACCCAATGAATCAATCAAAC -3'

[0079] Reverse primer: NtCIPK25-1R: 5'-TTAGTCTCTGCCATCATTCTCACC -3'

[0080] B. extract tobacco root tissue RNA, and reverse transcribe to obtain the first-strand cDNA;

[0081] C. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was performed with primers NtCIPK25-1F / NtCIPK25-1R, and the PCR product was separated by agarose gel electrophoresis and recovered and purified ( figure 1 );

[0082] D. Ligate the purified product with the carrier. The ligation system and process are as follows: 4 μL of the purified product, 1 μL of salt solution, 1 μL of PCR®-BluntⅡ-TOPO (Inv...

Embodiment 2

[0084] tobacco NtCIPK25-1 Gene tissue-specific expression analysis

[0085] A. Planting and cultivating tobacco Yunyan 87, Wang extracted RNA from roots, stems and leaves for a long time, and obtained the first-strand cDNA by reverse transcription.

[0086] B. According to NtCIPK25-1 Gene sequence design qRT-PCR primers

[0087] QF: 5'-TATATCAGCAATGTCTTCAGGA-3',

[0088] QR: 5'-GAATTCCTTAGCAGATTCAATCT-3'.

[0089]Tobacco Actin gene was used as an internal reference, Actin-F: CTGAGGTCCTTTTCCAACCA and Actin-RTACCCGGGAACATGGTAGAG. Fluorescent quantitative PCR was carried out using root, stem, and leaf cDNA as templates, and the reaction was carried out on RocheLightCycler 480 using LightCycler 480 SYBR Green I master. The 20 µL system contained 10 µL LightCycler 480 SYBR Green I master (2×), and 1 µL each of the forward and reverse primers. (10 µmol / L), 1 µL of cDNA (reverse transcription product diluted 4 times), 7 µL of sterilized distilled water. The reaction program was...

Embodiment 3

[0091] tobacco NtCIPK25-1 Gene-encoded protein conserved domain analysis

[0092] Multiple sequence alignment of NtCIPK25-1 protein and Arabidopsis AtNTCIPK25 protein ( image 3 ). NtCIPK25-1 has conserved domains of CIPK protein, such as transmembrane region serine / threonine protein kinase region S_TKc, C-terminal regulatory domain CIPK_c, and NtCIPK25-1 protein has high homology with Arabidopsis AtNTCIPK25 protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco protein kinase gene NtCIPK25-1 as well as a cloning method and application thereof. The nucleotide sequence of the tobacco protein kinase gene NtCIPK25-1 is as shownin SEQ ID NO. 1, and the amino acid sequence of encoded protein is as shown in SEQ ID NO. 2. The cloning method comprises the steps: synthesis of cDNA of tobacco leaves, specifically, extracting totalRNA of the tobacco leaves, and performing reverse transcription to obtain a first strand of the cDNA; and PCR amplification of the NtCIPK25-1 gene, specifically, using the cDNA of the tobacco leavesas a template, designing a primer according to the NtCIPK25-1 gene sequence, performing PCR amplification, recycling and purifying PCR amplification products, and performing sequencing. The application is characterized in that the tobacco protein kinase gene NtCIPK25-1 is used for obtaining transgenic tobacco plants with the tobacco potassium content regulated. The cloned NtCIPK25-1 gene is subjected to functional identification through a CRISPR / CAS9 technology. The cloning and identification of the tobacco NtCIPK25-1 gene provides a novel gene target for regulating the potassium content of tobacco.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a tobacco protein kinase gene NtCIPK25-1 And its cloning method and application. Background technique [0002] Ca 2+ Known as the second messenger in eukaryotic signal transduction, Ca 2+ Signal transduction is one of the important ways for plants to transmit information to the body after receiving external stress. There are three main types of Ca receptors in plants 2+ Signal receptors: calmodulin (CaM), calcium-dependent protein kinases (CDPKs) and calmodulin B-like protein family (CBL). CIPK (CBL-interacting protein kinase) protein is a plant-specific Ser / Thr protein kinase, which belongs to the plant SnRK3 protein kinase subfamily. CIPKs are CBL-specific target protein kinases, and the network system formed by the interaction of CBL-CIPKs is connected to a series of plant responses to external abiotic stress stimuli. For example, drought, high salinity, ABA,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/10C12N15/82A01H5/00A01H6/82
CPCC12N9/12C12N15/8243C12Y207/11
Inventor 高玉龙李梅云王丙武宋中邦焦芳婵吴兴富李文正赵璐李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com