Tobacco protein kinase gene NtCIPK1 as well as cloning method and application thereof
A technology of protein kinase gene and cloning method, applied in the field of tobacco protein kinase gene NtCIPK1 and its cloning
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Tobacco protein kinase gene NtCIPK1 Clone of
[0077] A. According to Arabidopsis AtCIPK1 The protein sequence of the gene (EFH61473.1) searched NCBI database to get the homologous gene in tobacco NtCIPK1 Sequence, use this sequence to design gene cloning primers:
[0078] Forward primer: NtCIPK1F: 5’- ATGGTATTGATACAGCAAGAAG -3’
[0079] Reverse primer: NtCIPK1R: 5’- TCATAATTTGGTGGGCAAGAGCTC -3’
[0080] B. Extract RNA from tobacco root tissue and reverse transcription to obtain the first strand cDNA;
[0081] C. Using the first-strand cDNA obtained by reverse transcription as a template, PCR amplification was carried out with primers NtCIPK1F / NtCIPK1R, and the PCR products were separated by agarose gel electrophoresis and then recovered and purified ( figure 1 );
[0082] D. Connect the purified product to the carrier. The connection system and process are as follows: 4μL of purified product, 1μL of salt solution, 1μL of PCR®-BluntⅡ-TOPO (Invitrogen), mix well, 25℃, water bat...
Embodiment 2
[0084] tobacco NtCIPK1 Gene tissue-specific expression analysis
[0085] A. To plant and cultivate tobacco Yunyan 87, extract RNA from roots, stems and leaves during the vigorous period, and reverse transcription to obtain the first strand cDNA.
[0086] B. According to NtCIPK1 Gene sequence design qRT-PCR primer
[0087] QF: 5’- TGGCAGAGATTAAAGAGGATGAG -3’,
[0088] QR: 5’- ACATCCCAATTAGCTGAAAGGC -3’.
[0089] Tobacco Actin gene was used as internal control, Actin-F: CTGAGGTCCTTTTCCAACCA and Actin-RTACCCGGGAACATGGTAGAG. Fluorescence quantitative PCR was performed using cDNA of roots, stems and leaves as templates. The reaction was performed on RocheLightCycler 480 using LightCycler 480 SYBR Green I master. The 20 µL system contained 10 µL LightCycler 480 SYBR Green I master (2×), and the forward and reverse primers were 1 µL each (10 µmol / L), cDNA 1 µL (reverse transcription product diluted 4 times), 7 µL sterilized distilled water. The reaction procedure is as follows: pre-denatura...
Embodiment 3
[0091] tobacco NtCIPK1 Analysis of Conserved Domains of Gene Coded Proteins
[0092] The NtCIPK1 protein was compared with the Arabidopsis AtCIPK1 protein in multiple sequence ( image 3 ). NtCIPK1 has CIPK protein conserved domains, such as transmembrane serine / threonine protein kinase domain S_TKc, C-terminal regulatory domain CIPK_c, and NtCIPK1 protein has high homology with Arabidopsis AtCIPK1 protein.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap