A kind of pcr amplification reagent and its application
An amplification reaction and reagent technology, applied in the direction of transferase, library creation, enzymes, etc., can solve the problems of poor amplification of the target area, poor results in terms of degree and yield, and insufficient sensitivity of reagents, etc., to achieve Improved sensitivity and compatibility, better library uniformity, improved sensitivity and yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] According to the conventional method, use Nanjing Nuoweizan Biotechnology Co., Ltd. Max Master Mix (P515) and Ultra One Step Cloning Kit (C115) performs site-directed mutation on Taq DNA polymerase (sequence shown in SEQID NO.1), and the primers used for point mutation are as follows to obtain a mutant, called Taq-Mut, whose mutation site The points are: K53N, G364D, R636H (the sequence is shown in SEQ ID NO.2), the nucleic acid sequence before mutation is shown in SEQ ID NO.3, and the nucleic acid sequence after mutation is shown in SEQ ID NO.4.
[0036] The primer sequences (5'-3') used for point mutations are as follows:
[0037] AB-1F: GGTATATCTCTTCTTAAAGATGAGGGGGATGCTGCCC
[0038] AB-1R: TCCTTGAGGGCGTTGAGGAGGCTCTTGGCGAAGC
[0039] BC-1F:CTCCTCAACGCCCTCAAGGAG
[0040] BC-1R: AGGCCAAGGTCTTCCCTCAGGGCCAGAACG
[0041] CD-1F: CTGAGGGAAGACCTTGGCCTC
[0042] CD-1R: CGTGTGGATGTCGTGCCCCTCCTGGAAG
[0043] DE-1F: AGGGGCACGACATCCACACGGAGACCGCCAGCTGGATGT
[0044] DE-1R...
Embodiment 2
[0049] Example 2 Application of Taq-Mut in Amplicon Library Construction
[0050] Use Taq-Mut to prepare the following different reaction systems for PCR:
[0051] Multiplex amplification reaction system 1: Taq-Mut 2U, Tris 25mM, KCl 20mM, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;
[0052] Multiplex amplification reaction system 2: Taq-Mut 2U, Tris 25mM, KCl 20mM, DMSO 2%, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;
[0053] Multiplex amplification reaction system 3: Taq-Mut 2U, Tris 25mM, KCl 50mM, DMSO 2%, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;
[0054] The above three systems were subjected to multiple amplification, and the input amount of 293T cell nucleic acid DNA was 1ng. The reaction procedure was as follows: 99°C for 2min; (99°C for 15sec; 60°C for 4min); 22 cycles; 72°C for 10min; 4°C hold. Run nucleic acid electrophoresis on a 3% agarose gel to obtain figure 2 The results shown, system 1 is...
Embodiment 3
[0056] The reagents required to prepare for multiplex amplification include the amplification reagent Multi-PCR Mix, which is 2× concentration, and the concentration of key components is: Taq-Mut 4U, Tris 50mM, KCl 100mM, DMSO 4%, MgCl 2 2mM, dNTP0.4mM, pH7.6. Combined with Adapters and Ligation Enzyme Mix required for conventional ligation, 207 primer pairs (Nanjing Nuoweizan Biotechnology Co., Ltd., VAHTSAmpSeq CancerHotSpot Panel NA102) were used to amplify hot spot mutation regions of human tumor-related genes. The samples were human FFPE samples and human One for each cfDNA sample, after extracting DNA in a conventional way, the reaction system (1×concentration): Taq-Mut 2U, Tris 25mM, KCl 50mM, MgCl 2 1mM, DMSO 2%, dNTP0.2mM, primer 10nM each, pH7.6, FFPE DNA input amount 10ng / cfDNA input amount 1ng, primer digestion, adapter ligation, purification, library amplification, library purification, and amplicon library WK1 was obtained , WK2, using ordinary wild-type Taq ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More