IL-12 protein mutant, preparation method and application of IL-12 protein mutant, NK cell culture system and NK cell culture method
A protein mutant, IL-12 technology, applied in the field of NK cell culture system and culture of NK cells, can solve the problems that cannot fully meet the practical application, the purity and killing activity of NK cells are not ideal, and achieve the effect of safe use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Example 1 Preparation of IL-12 protein mutants
[0068] (1) Obtain p40 subunit gene and p35 subunit gene by PCR
[0069] Using pcDNA-IL-12 p40-Flag plasmid and pcDNA-IL-12 p35-Flag plasmid as templates, the p40 subunit gene and p35 subunit gene were amplified respectively. Use F: 5'ATTGAATTCGCCGCCACCATGTGTCACCAGCAGTTG 3' and R: 5'GTTTCTGGAGCCACCACCGCCACTGCAGGGCACAGATGC 3' as primers to amplify the complete coding sequence of P40, and use F: 5'AGTGGCGGTGGTGGCTCCAGAAACCTCCCGTGGCC 3' and R: 5'ATTGGATCCTAGGAAGCATTCAGATA 3' as primers to amplify the complete coding sequence of P3. The PCR reaction parameters for amplifying the entire coding sequence of P40 and amplifying the full coding sequence of P35 were: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 2 min, 10 cycles. ℃ insulation. Afterwards, the products were identified and separated by 1.5% agarose gel elect...
Embodiment 2
[0079] The peripheral blood of healthy volunteers was aseptically collected with disposable sterile blood collection tubes containing EDTA anticoagulant, and the blood collection volume was 50 mL, in two copies.
[0080] (1) Coating of cell culture flasks
[0081] After adding 18ml of PBS to the T175 culture flask, add CD16 monoclonal antibody and Her2 monoclonal antibody and mix well. The concentrations of CD16 monoclonal antibody and Her2 monoclonal antibody are 1 μg / mL and 0.6mg / mL respectively, and cultured overnight in 4°C refrigerator or at 37°C In the box, the bag is at least 2h. Among them, CD16 monoclonal antibody and Her2 monoclonal antibody were purchased from Beckman Company of the United States.
[0082] (2) Autologous plasma preparation
[0083] Two 50 mL anticoagulated peripheral blood samples were centrifuged at 800 g for 15 min at room temperature. The supernatant plasma was taken and incubated in a water bath at 56°C for 30min, then transferred to a -20°C ...
Embodiment 3
[0088] Example 3 Culture of NK cells in vitro
[0089] On the 0th day, the 7th day, the 14th day and the 21st day, the cultured cells were taken from the control group and the experimental group, stained with trypan blue, counted, and the cell expansion times were calculated and the cell expansion curve was drawn. The expansion of the cells in the control group and the experimental group was compared. Among them, trypan blue dye solution was purchased from Beijing Suo Laibao Technology Co., Ltd.
[0090] The result is as figure 1 shown. figure 1 It shows that on the 7th day, the 14th day and the 21st day, the cell expansion multiple of the experimental group is higher than that of the control group, indicating that the IL-12 protein mutant can effectively stimulate the expansion of NK cells. The invention of NK cell culture system can effectively stimulate the expansion of NK cells.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More