Unlock instant, AI-driven research and patent intelligence for your innovation.

Chimeric antigen receptor targeting BCMA and application thereof

A chimeric antigen receptor and targeting technology, applied in the field of tumor cell immunotherapy, can solve the problems of unstable treatment effect and unpredictable treatment effect.

Active Publication Date: 2019-04-19
GUANGZHOU BIO GENE TECH CO LTD
View PDF6 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of technology, cells expressing chimeric antigen receptor (CAR) modifications have been used for treatment, but the therapeutic effect of the established antigen-binding domain used in CAR is unpredictable, resulting in unstable therapeutic effect
[0004] The use of BCMA antigens as ectodomains for the treatment of B cell-related diseases has been disclosed, but if the antigen-binding domain binds too strongly, then CAR T cells induce a large-scale release of cytokines, resulting in a potentially fatal disease that is regarded as a "cytokine storm". Immune response; however, if the antigen-binding domain binds too weakly, CAR T cells may not be sufficiently therapeutically effective in eradicating cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor targeting BCMA and application thereof
  • Chimeric antigen receptor targeting BCMA and application thereof
  • Chimeric antigen receptor targeting BCMA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Design of chimeric antigen receptor

[0058] In this example, an anti-BCMA chimeric antigen receptor (G8 CAR) was constructed, as shown in the sequence diagram figure 1 As shown, the chimeric antigen receptor includes a CD8α signal peptide sequence (Leader), a single domain antibody sequence (Anti-BCMA VHH) that specifically binds to the BCMA antigen, CD8α hinge region (Hinge) and transmembrane region sequences (Transmembrane), 4-1BB costimulatory domain sequence and CD3ζ signaling domain sequence, the specific partial sequences are as follows:

[0059] CD8α signal peptide (leader) amino acid sequence (SEQ ID NO. 5): MALPVTALLLPLALLLHAARP;

[0060] CD8α signal peptide (leader) nucleotide sequence (SEQ ID NO.6): ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCA CGCAGCACGCCCT;

[0061] The amino acid sequence (SEQ ID NO.7) of the hinge region (hinge) of CD8α: TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD;

[0062] The nucleotide sequence of the hinge region of CD8α (SE...

Embodiment 2

[0069] Example 2: Construction of anti-BCMA chimeric antigen receptor expression vector

[0070] (1) Complete gene synthesis of G8 CAR sequence, digest the fully synthesized G8 CAR and empty vector with EcoRI and BamHI. After digestion in 37℃ water bath for 30 minutes, use 1.5% agarose gel for DNA electrophoresis, then Use Tiangen's agarose gel kit for purification and recovery;

[0071] (2) The connection of pCDH-EF1-MCS vector and G8 CAR gene fragment:

[0072] The connection system is as follows:

[0073] Component

Adding amount (μl)

PCDH-EF1-MCS vector

2(50ng)

G8 CAR gene

10(150ng)

T4 DNA ligation buffer

2

T4 DNA Ligase (NEB)

1

dd H 2 O

5

In total

20

[0074] After ligation at 22°C for 1 hour, the ligation product was directly transformed into Stbl3 E. coli competent cells. 200 μl of the transformed product was coated on an ampicillin-resistant LB plate. The LB plate was cultured upside down in an incubator at 37°C overnight. Three single clones were randomly sele...

Embodiment 3

[0076] Example 3: Lentivirus packaging

[0077] The lentiviral expression vectors in the examples were separately packaged with a four-plasmid system. The specific steps are as follows:

[0078] (1) The four-plasmid system expresses the gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, the total mass is 10μg;

[0079] (2) Add the above plasmid to a certain volume of serum-free DMEM, mix well and leave it for 15 minutes, add the above mixture to the T75 culture flask with 293T cells, mix gently, and hold at 37°C. , 5% CO 2 Culture in a cell incubator for 6 hours;

[0080] (3) After 6 hours, replace the fresh medium, continue the culture, and add 10 mM sodium butyrate solution. After 72 hours, collect the culture supernatant of the lentivirus for purification detection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chimeric antigen receptor targeting BCMA, which comprises an extracellular domain capable of binding to an antigen, a transmembrane domain and at least one intracellular domain, wherein the extracellular domain is an anti-BCMA single domain antibody; wherein the amino acid sequence of the anti-BCMA single domain antibody is selected from: (a) an amino acid sequence as shown in SEQ ID NO. 1; or (b) a variant which is formed by substitution, addition or deletion of one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1 and which is capable of specifically binding to the chimeric antigen receptor and has a function of binding to BCMA and inducing T cell signaling conduction. The chimeric antigen receptor has smaller clinical side effects and highersafety, can effectively reduce solid tumor focus and effectively improve the treatment effect of tumors.

Description

Technical field [0001] The present invention relates to the field of cellular immunotherapy for tumors, in particular to a chimeric antigen receptor targeting BCMA and its application, specifically a chimeric antigen receptor T (CAR-T) cell technology based on a specific target BCMA The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Generally, the CAR contains the single chain fragment variable (scFv) of the antibody or the binding domain specific for tumor associated antigen (TAA), which communicates with T cell signals through the hinge and transmembr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K35/17A61P35/00
CPCA61K35/17A61P35/00C07K14/7051C07K14/70517C07K14/70521C07K14/70578C07K16/2878C07K2317/569C07K2319/00C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N5/0636C12N15/86C12N2510/00C12N2740/15043C12N2800/107
Inventor 李光超罗敏曾剑华郭锦涛莫文俊
Owner GUANGZHOU BIO GENE TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More