Chimeric antigen receptor targeting BCMA and application thereof
A chimeric antigen receptor and targeting technology, applied in the field of tumor cell immunotherapy, can solve the problems of unstable treatment effect and unpredictable treatment effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Design of chimeric antigen receptor
[0058] In this example, an anti-BCMA chimeric antigen receptor (G8 CAR) was constructed, as shown in the sequence diagram figure 1 As shown, the chimeric antigen receptor includes a CD8α signal peptide sequence (Leader), a single domain antibody sequence (Anti-BCMA VHH) that specifically binds to the BCMA antigen, CD8α hinge region (Hinge) and transmembrane region sequences (Transmembrane), 4-1BB costimulatory domain sequence and CD3ζ signaling domain sequence, the specific partial sequences are as follows:
[0059] CD8α signal peptide (leader) amino acid sequence (SEQ ID NO. 5): MALPVTALLLPLALLLHAARP;
[0060] CD8α signal peptide (leader) nucleotide sequence (SEQ ID NO.6): ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCA CGCAGCACGCCCT;
[0061] The amino acid sequence (SEQ ID NO.7) of the hinge region (hinge) of CD8α: TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD;
[0062] The nucleotide sequence of the hinge region of CD8α (SE...
Embodiment 2
[0069] Example 2: Construction of anti-BCMA chimeric antigen receptor expression vector
[0070] (1) Complete gene synthesis of G8 CAR sequence, digest the fully synthesized G8 CAR and empty vector with EcoRI and BamHI. After digestion in 37℃ water bath for 30 minutes, use 1.5% agarose gel for DNA electrophoresis, then Use Tiangen's agarose gel kit for purification and recovery;
[0071] (2) The connection of pCDH-EF1-MCS vector and G8 CAR gene fragment:
[0072] The connection system is as follows:
[0073] Component
Adding amount (μl)
PCDH-EF1-MCS vector
2(50ng)
G8 CAR gene
10(150ng)
T4 DNA ligation buffer
2
T4 DNA Ligase (NEB)
1
dd H 2 O
5
In total
20
[0074] After ligation at 22°C for 1 hour, the ligation product was directly transformed into Stbl3 E. coli competent cells. 200 μl of the transformed product was coated on an ampicillin-resistant LB plate. The LB plate was cultured upside down in an incubator at 37°C overnight. Three single clones were randomly sele...
Embodiment 3
[0076] Example 3: Lentivirus packaging
[0077] The lentiviral expression vectors in the examples were separately packaged with a four-plasmid system. The specific steps are as follows:
[0078] (1) The four-plasmid system expresses the gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, the total mass is 10μg;
[0079] (2) Add the above plasmid to a certain volume of serum-free DMEM, mix well and leave it for 15 minutes, add the above mixture to the T75 culture flask with 293T cells, mix gently, and hold at 37°C. , 5% CO 2 Culture in a cell incubator for 6 hours;
[0080] (3) After 6 hours, replace the fresh medium, continue the culture, and add 10 mM sodium butyrate solution. After 72 hours, collect the culture supernatant of the lentivirus for purification detection.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap