A chimeric antigen receptor targeting bcma and its application
A chimeric antigen receptor and targeting technology, applied in the field of tumor cell immunotherapy, can solve the problems of unpredictable and unstable therapeutic effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Design of Chimeric Antigen Receptors
[0058] This example constructs an anti-BCMA chimeric antigen receptor (G8 CAR), as shown in the sequence diagram figure 1 As shown, the chimeric antigen receptor includes a signal peptide sequence (Leader) of CD8α, a single domain antibody sequence (Anti-BCMA VHH) specifically binding to BCMA antigen, a hinge region (Hinge) and a transmembrane region sequence of CD8α (Transmembrane), 4-1BB co-stimulatory domain sequence and CD3ζ signaling domain sequence, the specific sequences of each part are as follows:
[0059] Amino acid sequence (SEQ ID NO.5) of CD8α signal peptide (leader): MALPVTALLLPLALLLLHAARP;
[0060] The nucleotide sequence (SEQ ID NO.6) of CD8α signal peptide (leader): ATGGCACTGCCAGTGACAGCCCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCAGCACGCCCT;
[0061] The amino acid sequence (SEQ ID NO.7) of CD8α hinge region (hinge): TTTPARPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD;
[0062] The nucleotide sequence (SEQ ID NO.8) of C...
Embodiment 2
[0069] Example 2: Construction of an anti-BCMA chimeric antigen receptor expression vector
[0070] (1) Synthesize the G8 CAR sequence of the whole gene, double digest the G8 CAR and the empty vector synthesized by the whole gene with EcoRI and BamHI, digest it in a water bath at 37°C for 30 minutes, use 1.5% agarose gel for DNA electrophoresis, and then Use Tiangen's agarose gel kit for purification and recovery;
[0071] (2) Connection of pCDH-EF1-MCS vector and G8 CAR gene fragment:
[0072] The connection system is as follows:
[0073] components Amount added (μl) PCDH-EF1-MCS vector 2(50ng) G8 CAR gene 10(150ng) T4 DNA Ligation Buffer 2 T4 DNA Ligase (NEB) 1 dd H 2 o
5 total 20
[0074] After ligation at 22°C for 1 h, the ligation product was directly transformed into Stbl3 Escherichia coli competent cells, and 200 μl of the transformation product was coated with an ampicillin-resistant LB plate, and the LB plate...
Embodiment 3
[0076] Example 3: Lentiviral packaging
[0077] The lentiviral expression vectors in the examples were respectively packaged with lentiviruses, using a four-plasmid system, and the specific steps were as follows:
[0078] (1) The four-plasmid system respectively expresses gag / pol, Rev, VSV-G required for lentiviral vector packaging and the artificial chimeric antigen receptor composed of the engineered and stable single-chain antibody of the present invention: the four plasmids are transiently transfected into 293T Cells, with a total mass of 10 μg;
[0079] (2) Add the above-mentioned plasmid into a certain volume of serum-free DMEM, mix well and let it stand for 15 minutes, add the above-mentioned mixture into a T75 culture flask lined with 293T cells, mix gently, and incubate at 37°C , 5%CO 2 Cultivate in a cell incubator for 6 hours;
[0080] (3) Replace the fresh medium after 6 hours, continue the culture, and add 10 mM sodium butyrate solution, and collect the culture...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com