A method of enhancing fatty acid degradation and glyoxylate cycle to increase threonine production
A threonine and nucleotide sequence technology, applied in the fields of genetic engineering and fermentation engineering, can solve problems such as low conversion rate, low conversion rate, and short fermentation cycle of E. coli, and achieve less carbon source loss and higher conversion rate , The effect of increasing the production of threonine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Construction of fadR, fabR, lacI knockout strains
[0043] On the basis of the starting strain TWF006 (the paper "Increasing l-threonine production in Escherichia coli by engineering the glyoxylate shunt and the l-threonine biosynthesis pathway" published in 2018), the CRISPR Cas9 editing system was used for gene knockout and insertion. Use primers lacI-sgRAN-F and sgRNA-R to amplify the linear fragment, phosphorylate and circularize the amplified product, construct the targeting plasmid pTargetF-lacI, transform the cloning host, and extract the plasmid; construct the targeting fragment for fadR knockout, and use primers lacIf1 and lacIr1 were used to amplify the upstream homology arm, and primers lacIf2 and lacIr2 were used to amplify the downstream homology arm, and the upper and lower homology arms were overlapped and fused together by PCR as the targeting fragment. 100ng of plasmid pTargetF-lacI and 400ng of targeting fragment were co-transformed into TWF...
Embodiment 2
[0046] Example 2: Replace the promoter of the acs gene with a synthetic promoter P tac-trc
[0047] According to the method of Example 1, the targeting plasmid pTargetF-acs was constructed. The synthetic sequence was synthesized by a third-party company and integrated on the vector plasmid, and primers were designed using the start and end sequences of the synthetic fragment, with corresponding upstream or downstream homologous sequences at both ends of the primers, wherein the upstream homologous sequence is GCCCAAATACTAAACAAAACTGCCAATACCCCCTACATTTAACGCT; downstream The homologous sequence is ATGAGCCAAATTCACAAAACACACCATTCCTGCCAACATCGCAG, and the amplified product is the targeting fragment. The middle of the targeting fragment is a synthetic promoter, and the two ends each have homology arms upstream and downstream of the targeting site. The targeting plasmid and the targeting fragment were co-transformed into the strain TWF033 constructed in Example 1, and the positive tran...
Embodiment 3
[0048] Example 3: Insertion of the prespeed gene at the lac operator site
[0049] Utilize the corresponding primers and the aforementioned similar method to construct the targeting plasmid pTargetF-fadB; utilize primers lacZ1f1 and lacZ1r1 to amplify the upstream homology arms, lacIr1 and lacIf2 to amplify the downstream homology arms, and overlap PCR to fuse the upstream and downstream homology arms (using primers at both ends Each has EcoRI and HindIII restriction sites, and the upper and lower homology arms have XbaI and SalI restriction sites in the middle), the fragment and the prespeed plasmid are jointly digested and connected with EcoRI and HindIII to construct pTargetT-fadB, and transform the clone Host, extract the plasmid; use primers fadBA-F and fadBA-R (respectively with XbaI and SalI restriction sites) to amplify the insert fragment, recover the fragment, and connect the fragment and the previous step plasmid with XbaI and SalI restriction digestion to construct ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More