Combinant vaccinia virus surface display system vector plasmid and application thereof
A vaccinia virus, surface display technology, applied in the direction of virus/bacteriophage, application, biochemical equipment and methods, etc., can solve the problems of crowding out enzyme cutting sites, complicated operation steps, and difficulty in constructing transfer vector plasmids
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Construction of recombinant plasmid pVTK-CZ
[0022] (1) PCR primers
[0023] HN-1 (SEQ ID No. 14): atcatgatgtagaagcttggttaggagctagagtaccattagtagaaactgtgagcaagggcgaggag
[0024] HN-2 (SEQ ID No. 15): taatacgactcactataggagggccaccccaccatgcaccatcatcatcatcatcatgatgtagaagcttg
[0025] HN-3 (SEQ ID No. 16): gctgcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgactcactatag
[0026] HN-4 (SEQ ID No. 17): aggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataagctgcagcacgtgttgac
[0027] HN-5 (SEQ ID No. 18): gtctagaactagtaaaaattgaaaataaatacaaaggttcttgagggttgtg
[0028] TMD-1 (SEQ ID No. 19): ctatggcaataattgcgaatgttttattctcttcgatatatttttggtcctgctcctcggccacgaag
[0029] TMD-2 (SEQ ID No. 20): tcgtcgactcataaaaaagagaatagcggtaagtataaacacgaatactatggcaataattgcgaatg
[0030] TMD-3 (SEQ ID No. 21): tcgactagatctattagttttgtttttctcgcgaatatcgtcgactcataaaaaagag
[0031] (2) The general PCR reaction system is as follows:
[0032]
[0033] (3) The PCR reaction process was as...
Embodiment 2
[0046] Example 2: Construction and screening of recombinant vaccinia virus
[0047] Method 1: Classical Resistance-Fluorescent Plaque Purification Screening
[0048] Vero cells were seeded in 6-well plates and allowed to grow to 80% pellets the next day. Lipofectamine2000 liposomes were transfected into pVTK-CZ recombinant plasmids, 4μg pVTK-CZ plasmid was diluted in 250μL serum-free DMEM medium as solution A, and 10μL liposomes were diluted in 250μL serum-free DMEM medium as Solution B, after mixing solution A and solution B, incubate at room temperature for 20 min, then add 300 μL of serum-free DMEM, mix well, add the mixture to the cells washed twice with HanKs solution, 37 ℃, 5% CO 2 After culturing in an incubator for 4 hours, add 10 μL of wild-type vaccinia virus WR strain to each well, at 37°C, 5% CO. 2 After incubating in the incubator for 2 hours, add 2 mL of DMEM medium containing 2% FCS to each well, 37 °C, 5% CO. 2 Continue culturing in the incubator, collect va...
Embodiment 3
[0060] Example 3: Validation of recombinant vaccinia virus with surface display of target gene
[0061] Hereinafter, the recombinant vaccinia virus VV-mC / Z-D8 is used as an example to illustrate.
[0062] (1) ELISA detection of His-tag polypeptides displayed on the surface of VV-mC / Z-D8 virus
[0063] Recombinant vaccinia virus VV-mC / Z-D8 was amplified in Vero cells to a viral titer of 10 8 pfu / mL, inactivated virus with a final concentration of 0.4% formalin at 37°C, resuspended in carbonate buffer pH 9.6, coated 96-well ELISA plate, 100μL / well, overnight at 4°C, washed with PBST 3 2 min each time, pat dry, add 300 μL of PBST blocking solution containing 5% FCS to each well, block at room temperature for 4 h, wash 3 times with PBST, 2 min each time, pat dry, add 0.5% FCS to each well to dilute (1 : 200) mouse anti-His-tag antibody ("primary antibody") at 37°C for 2 h, washed 3 times with PBST for 2 min each, patted dry, added with PBST containing 0.5% FCS to dilute (1:1000)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


