Combinant vaccinia virus surface display system vector plasmid and application thereof

A vaccinia virus, surface display technology, applied in the direction of virus/bacteriophage, application, biochemical equipment and methods, etc., can solve the problems of crowding out enzyme cutting sites, complicated operation steps, and difficulty in constructing transfer vector plasmids

Pending Publication Date: 2019-05-03
ZHEJIANG ACAD OF MEDICAL SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have certain limitations, such as complicated operation steps and low screening efficiency.
In addition, some screening marker genes such as LacZ are relatively large, which will crowd out the commonly used enzyme cutting sites, making it difficult to construct transfer vector plasmids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Combinant vaccinia virus surface display system vector plasmid and application thereof
  • Combinant vaccinia virus surface display system vector plasmid and application thereof
  • Combinant vaccinia virus surface display system vector plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Construction of recombinant plasmid pVTK-CZ

[0022] (1) PCR primers

[0023] HN-1 (SEQ ID No. 14): atcatgatgtagaagcttggttaggagctagagtaccattagtagaaactgtgagcaagggcgaggag

[0024] HN-2 (SEQ ID No. 15): taatacgactcactataggagggccaccccaccatgcaccatcatcatcatcatcatgatgtagaagcttg

[0025] HN-3 (SEQ ID No. 16): gctgcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgactcactatag

[0026] HN-4 (SEQ ID No. 17): aggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataagctgcagcacgtgttgac

[0027] HN-5 (SEQ ID No. 18): gtctagaactagtaaaaattgaaaataaatacaaaggttcttgagggttgtg

[0028] TMD-1 (SEQ ID No. 19): ctatggcaataattgcgaatgttttattctcttcgatatatttttggtcctgctcctcggccacgaag

[0029] TMD-2 (SEQ ID No. 20): tcgtcgactcataaaaaagagaatagcggtaagtataaacacgaatactatggcaataattgcgaatg

[0030] TMD-3 (SEQ ID No. 21): tcgactagatctattagttttgtttttctcgcgaatatcgtcgactcataaaaaagag

[0031] (2) The general PCR reaction system is as follows:

[0032]

[0033] (3) The PCR reaction process was as...

Embodiment 2

[0046] Example 2: Construction and screening of recombinant vaccinia virus

[0047] Method 1: Classical Resistance-Fluorescent Plaque Purification Screening

[0048] Vero cells were seeded in 6-well plates and allowed to grow to 80% pellets the next day. Lipofectamine2000 liposomes were transfected into pVTK-CZ recombinant plasmids, 4μg pVTK-CZ plasmid was diluted in 250μL serum-free DMEM medium as solution A, and 10μL liposomes were diluted in 250μL serum-free DMEM medium as Solution B, after mixing solution A and solution B, incubate at room temperature for 20 min, then add 300 μL of serum-free DMEM, mix well, add the mixture to the cells washed twice with HanKs solution, 37 ℃, 5% CO 2 After culturing in an incubator for 4 hours, add 10 μL of wild-type vaccinia virus WR strain to each well, at 37°C, 5% CO. 2 After incubating in the incubator for 2 hours, add 2 mL of DMEM medium containing 2% FCS to each well, 37 °C, 5% CO. 2 Continue culturing in the incubator, collect va...

Embodiment 3

[0060] Example 3: Validation of recombinant vaccinia virus with surface display of target gene

[0061] Hereinafter, the recombinant vaccinia virus VV-mC / Z-D8 is used as an example to illustrate.

[0062] (1) ELISA detection of His-tag polypeptides displayed on the surface of VV-mC / Z-D8 virus

[0063] Recombinant vaccinia virus VV-mC / Z-D8 was amplified in Vero cells to a viral titer of 10 8 pfu / mL, inactivated virus with a final concentration of 0.4% formalin at 37°C, resuspended in carbonate buffer pH 9.6, coated 96-well ELISA plate, 100μL / well, overnight at 4°C, washed with PBST 3 2 min each time, pat dry, add 300 μL of PBST blocking solution containing 5% FCS to each well, block at room temperature for 4 h, wash 3 times with PBST, 2 min each time, pat dry, add 0.5% FCS to each well to dilute (1 : 200) mouse anti-His-tag antibody ("primary antibody") at 37°C for 2 h, washed 3 times with PBST for 2 min each, patted dry, added with PBST containing 0.5% FCS to dilute (1:1000)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a combinant vaccinia virus surface display system vector plasmid and an application thereof. The expression cassette core components of the vaccinia vector plasmid display system include a modified vaccinia virus H5 promoter, an E. coli EM7 promoter, a tandem histidine tag, a streptavidin-binding polypeptide fragment Nano-tag15, red Fluorescent protein mCherry, Zeocin resistance protein, and a vaccinia virus D8 protein transmembrane region. The recombinant vaccinia virus constructed based on the above plasmid can display Nano-tag15 on the surface of the outer membrane of the virus, the recombinant virus can be captured by streptavidin magnetic beads, and the red fluorescent protein mCherry and Zeocin resistance markers can be displayed on the surface, and by singleor combined usage of magnetic bead sorting, fluorescent labeling tracing, flow cytometry sorting and drug resistance, a powerful new means is provided for rapid screening of the recombinant vaccinia virus.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant vaccinia virus surface display system vector plasmid and its application. Background technique [0002] Vaccinia virus (vaccinia virus) is one of the largest and most complex viruses discovered to date, and it is a live vaccine virus against smallpox. After the global eradication of smallpox, vaccinia virus has been deeply studied and widely used as a genetically engineered expression vector. Based on the following characteristics of the virus, it has been more and more widely used in the field of tumor gene therapy: ①Safety: vaccinia virus is the only DNA virus that can replicate in the cytoplasm, it will not integrate into the host cell genome, and has no carcinogenicity (2) High expression efficiency: vaccinia virus can be cultured to a very high titer (>10 9 pfu / ml), usually infect for 1-3 hours, without any drug resistance screening, more than 90% of the infec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/863C12N7/01C12R1/93
Inventor阎辉罗砚曦刘美丽
OwnerZHEJIANG ACAD OF MEDICAL SCI