Sorghum 14-3-3 protein GF14a gene and recombinant vector and expression method thereof

A recombinant vector and gene technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve the problems that have not yet been reported on 14-3-3 protein gene research.

Inactive Publication Date: 2019-05-28
GUIZHOU UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no research report on 14-3-3 protein gene in sorghum at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sorghum 14-3-3 protein GF14a gene and recombinant vector and expression method thereof
  • Sorghum 14-3-3 protein GF14a gene and recombinant vector and expression method thereof
  • Sorghum 14-3-3 protein GF14a gene and recombinant vector and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Acquisition and Analysis of Sorghum 14-3-3 Protein GF14a Gene

[0033] According to the reported protein sequence of the maize GF14a gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene GF14a (gene number Sb03g028430). Search the NCBI database with GF14a protein, download the GF14a gene in other species, and use MEGA 7.0 software to construct an unrooted phylogenetic tree with Neighbor-Joining (NJ) (bootstrap=1000). figure 1 It can be seen that GF14a and maize GF14a are clustered together and have the closest relationship.

Embodiment 2

[0034] Example 2: Construction and Identification of Sorghum 14-3-3 Protein GF14a Gene Recombination Vector

[0035] 1. Extract sorghum RNA and reverse transcribe cDNA

[0036] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was reverse-transcribed with a reverse transcription kit (Promega).

[0037] 2. Using cDNA as a template to amplify the GF14a gene;

[0038] Primers were designed to amplify GF14a gene using cDNA as template.

[0039] Primers are as follows:

[0040] Upstream primer: GF14a-F: GC GAATTC ATGGCCGCCGCCGCC is underlined as the BamHI restriction site;

[0041] Downstream primer: GF14a-R: CG CTCGAG The underline of CTACTCATCATCAGGCTTGCTTG is the XhoI restriction site;

[0042] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.

[0043] The PCR amplification system used for gene amplification o...

Embodiment 3

[0048] Example 3: Induced expression of GF14a protein

[0049] 1. Obtain the recombinant prokaryotic expression strain of GF14a

[0050] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - Extract the GF14a recombinant expression vector, take the recombinant expression vector plasmid and transform it into Escherichia coli expression strains BL21(DE3), JM109(DE3), Rosetta(DE3), BL21(DE3)pLysS, Tuner(DE3), NovaBlue(DE3) to detect GF14a protein expression.

[0051] 2. Cultivate the activated strain overnight

[0052] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3), and NovaBlue(DE3) strains to 50ug / mL kanamycin liquid medium, and transfer Rosetta(DE3), BL21(DE3)pLysS strains Transfer to 50ug / mL kanamycin+50ug / mL chloramphenicol liquid medium, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sorghum 14-3-3 protein GF14a gene with a nucleotide sequence shown in SEQ ID NO.1. The invention also discloses a protein encoded by the sorghum 14-3-3 protein GF14a gene, with an amino acid sequence shown in SEQ ID NO.2. The present invention also discloses a recombinant vector comprising the above sorghum 14-3-3 protein GF14a gene and expression method of the above sorghum 14-3-3 protein GF14a gene. By the protein sequence of the corn GF14a gene, the homologous gene GF14a of sorghum is obtained from a sorghum genomic database, the gene is 780 bp in length, a prokaryotic expression vector is constructed according to the gene and is purified by a protein purification system, and the result thereof lays the foundation for further research on the crystal structure and biological characteristics of the protein, to further provide a basis for improving the stress resistance of sorghum by genetic editing methods.

Description

technical field [0001] The invention relates to a sorghum 14-3-3 protein GF14a gene, a recombinant vector and an expression method thereof, and belongs to the field of biotechnology. Background technique [0002] Sorghum (Sorghum bicolor (L.) Moench), also known as water millet and chestnut, is an important cereal crop with strong resistance to adversity. It is an important raw material, and it is also a kind of animal husbandry crop that has been widely used in recent years. Sorghum has a long history of cultivation in my country, and it was not cultivated on a large scale before the founding of the People's Republic of China. It was not until the 1970s, with the development of economy and society, that my country gradually paid attention to and cultivated sorghum on a large scale. Sorghum is a short-day C4 plant. Compared with other energy crops, sorghum has more obvious photosynthetic efficiency and higher yield advantages, so it is known as a "high-energy crop". In rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/70
Inventor谢鑫蒋君梅陈俊李向阳任明见
OwnerGUIZHOU UNIV