Sorghum 14-3-3 protein GF14a gene and recombinant vector and expression method thereof
A recombinant vector and gene technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve the problems that have not yet been reported on 14-3-3 protein gene research.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Acquisition and Analysis of Sorghum 14-3-3 Protein GF14a Gene
[0033] According to the reported protein sequence of the maize GF14a gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene GF14a (gene number Sb03g028430). Search the NCBI database with GF14a protein, download the GF14a gene in other species, and use MEGA 7.0 software to construct an unrooted phylogenetic tree with Neighbor-Joining (NJ) (bootstrap=1000). figure 1 It can be seen that GF14a and maize GF14a are clustered together and have the closest relationship.
Embodiment 2
[0034] Example 2: Construction and Identification of Sorghum 14-3-3 Protein GF14a Gene Recombination Vector
[0035] 1. Extract sorghum RNA and reverse transcribe cDNA
[0036] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was reverse-transcribed with a reverse transcription kit (Promega).
[0037] 2. Using cDNA as a template to amplify the GF14a gene;
[0038] Primers were designed to amplify GF14a gene using cDNA as template.
[0039] Primers are as follows:
[0040] Upstream primer: GF14a-F: GC GAATTC ATGGCCGCCGCCGCC is underlined as the BamHI restriction site;
[0041] Downstream primer: GF14a-R: CG CTCGAG The underline of CTACTCATCATCAGGCTTGCTTG is the XhoI restriction site;
[0042] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.
[0043] The PCR amplification system used for gene amplification o...
Embodiment 3
[0048] Example 3: Induced expression of GF14a protein
[0049] 1. Obtain the recombinant prokaryotic expression strain of GF14a
[0050] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - Extract the GF14a recombinant expression vector, take the recombinant expression vector plasmid and transform it into Escherichia coli expression strains BL21(DE3), JM109(DE3), Rosetta(DE3), BL21(DE3)pLysS, Tuner(DE3), NovaBlue(DE3) to detect GF14a protein expression.
[0051] 2. Cultivate the activated strain overnight
[0052] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3), and NovaBlue(DE3) strains to 50ug / mL kanamycin liquid medium, and transfer Rosetta(DE3), BL21(DE3)pLysS strains Transfer to 50ug / mL kanamycin+50ug / mL chloramphenicol liquid medium, and...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap