Construction method of immunodeficiency rat animal model and application
A construction method and immunodeficiency technology, applied in the field of construction of immunodeficiency rat animal models, can solve problems such as unrealistic and ineffective control of research costs, and achieve the effect of short time period, simplified identification process, and promotion of basic research.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Construction of the CRISPR-Cas9 expression system for Rag1, Rag2 and Il2rg genes
[0045] Rag1, Rag2 and Il2rg knockout mice were established using CRISPR / Cas9 technology.
[0046] Such as figure 1 as shown, figure 1 A in the figure means: targeting sequences were designed for the second exon of Rag1 gene, the third exon of Rag2 gene and the first exon of Il2rg gene. figure 1 B in represents: the base deletion and insertion mutations generated.
[0047] 1. According to the rat Rag1, Rag2 and Il2rg gene sequences, the sgRNA was designed and the sequence information of the sgRNA was obtained.
[0048] Among them, the DNA sequence of the sgRNA specifically targeting the second exon of Rag1 gene is shown in SEQ ID NO.1 (GAGTCTCAGGGTAGATGGCA). Among them, SEQ ID NO.1 targets SEQ ID NO.4 (SEQ ID NO.4 is a part of Rag1 gene). The forward and reverse single strands of SEQ ID NO.7 and SEQ ID NO.8 were synthesized respectively, and then annealed to form SEQ ID NO.1...
Embodiment 2
[0063] Example 2 In vitro transcription
[0064] T7-Cas9 PCR and T7-sgRNA PCR products are used for in vitro transcription mediated by T7 promoter, that is, T7 promoter is used as the promoter of in vitro transcription, and RNA polymerase is used to realize the transcription process from DNA to mRNA in vitro, specifically The method is as follows: use the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies) to transcribe the T7-Cas9 PCR product in vitro, and use the MEGAshortscript T7 kit (Life Technologies) to transcribe the T7-sgRNA PCR product in vitro. The mRNA produced by transcription was purified. The specific method was: Cas9 mRNA was purified by MEGAclear kit (Life Technologies), sgRNAs were purified by ethanol precipitation, mRNA was dissolved in pure water, and the concentration of purified mRNA was measured by spectrophotometer.
[0065] T7-Cas9 PCR primers are shown in Table 4, T7-sgRNA PCR primers are shown in Table 5, gRNA-Rag1-F, gRNA-Rag2-F, gRNA-Il2rg-F are res...
Embodiment 3
[0075] Example 3 Preparation of Gene Knockout Rats Using CRISPR-Cas9 System mRNA for Rag1, Rag2 and Il2rg Genes
[0076] 1. Pronuclear injection and embryo transfer
[0077] Get the pronuclear fertilized egg of the rat, and inject the premixed Cas9mRNA / sgRNA mixture (the final concentration of Cas9mRNA is 20ng / μl and the final concentration of sgRNA is 10ng / μl) obtained in the foregoing Example 2 into The cytoplasm of fertilized rat eggs is then transplanted into the oviduct of recipient mother mice to produce gene-targeted rats. The injection volume of the aforementioned Cas9mRNA / sgRNA mixture is 0.5-1ul.
[0078] 2. Genotype identification
[0079] After the birth of the surrogate mother mice, cut off about 1 cm of the mouse tail when the offspring grow to 2 weeks old, digest with proteinase K at 55°C, and extract the genome DNA of the mouse tail with phenolic extraction. Using rat genomic DNA as a template, primers were designed for the second exon of the Rag1 gene, the t...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com