Construction method of immunodeficiency rat animal model and application

A construction method and immunodeficiency technology, applied in the field of construction of immunodeficiency rat animal models, can solve problems such as unrealistic and ineffective control of research costs, and achieve the effect of short time period, simplified identification process, and promotion of basic research.

Inactive Publication Date: 2019-06-11
EYECURE THERAPEUTICS INC JIANGSU
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If large mammals or even non-human primates that are closer to humans are used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of immunodeficiency rat animal model and application
  • Construction method of immunodeficiency rat animal model and application
  • Construction method of immunodeficiency rat animal model and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of the CRISPR-Cas9 expression system for Rag1, Rag2 and Il2rg genes

[0045] Rag1, Rag2 and Il2rg knockout mice were established using CRISPR / Cas9 technology.

[0046] Such as figure 1 as shown, figure 1 A in the figure means: targeting sequences were designed for the second exon of Rag1 gene, the third exon of Rag2 gene and the first exon of Il2rg gene. figure 1 B in represents: the base deletion and insertion mutations generated.

[0047] 1. According to the rat Rag1, Rag2 and Il2rg gene sequences, the sgRNA was designed and the sequence information of the sgRNA was obtained.

[0048] Among them, the DNA sequence of the sgRNA specifically targeting the second exon of Rag1 gene is shown in SEQ ID NO.1 (GAGTCTCAGGGTAGATGGCA). Among them, SEQ ID NO.1 targets SEQ ID NO.4 (SEQ ID NO.4 is a part of Rag1 gene). The forward and reverse single strands of SEQ ID NO.7 and SEQ ID NO.8 were synthesized respectively, and then annealed to form SEQ ID NO.1...

Embodiment 2

[0063] Example 2 In vitro transcription

[0064] T7-Cas9 PCR and T7-sgRNA PCR products are used for in vitro transcription mediated by T7 promoter, that is, T7 promoter is used as the promoter of in vitro transcription, and RNA polymerase is used to realize the transcription process from DNA to mRNA in vitro, specifically The method is as follows: use the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies) to transcribe the T7-Cas9 PCR product in vitro, and use the MEGAshortscript T7 kit (Life Technologies) to transcribe the T7-sgRNA PCR product in vitro. The mRNA produced by transcription was purified. The specific method was: Cas9 mRNA was purified by MEGAclear kit (Life Technologies), sgRNAs were purified by ethanol precipitation, mRNA was dissolved in pure water, and the concentration of purified mRNA was measured by spectrophotometer.

[0065] T7-Cas9 PCR primers are shown in Table 4, T7-sgRNA PCR primers are shown in Table 5, gRNA-Rag1-F, gRNA-Rag2-F, gRNA-Il2rg-F are res...

Embodiment 3

[0075] Example 3 Preparation of Gene Knockout Rats Using CRISPR-Cas9 System mRNA for Rag1, Rag2 and Il2rg Genes

[0076] 1. Pronuclear injection and embryo transfer

[0077] Get the pronuclear fertilized egg of the rat, and inject the premixed Cas9mRNA / sgRNA mixture (the final concentration of Cas9mRNA is 20ng / μl and the final concentration of sgRNA is 10ng / μl) obtained in the foregoing Example 2 into The cytoplasm of fertilized rat eggs is then transplanted into the oviduct of recipient mother mice to produce gene-targeted rats. The injection volume of the aforementioned Cas9mRNA / sgRNA mixture is 0.5-1ul.

[0078] 2. Genotype identification

[0079] After the birth of the surrogate mother mice, cut off about 1 cm of the mouse tail when the offspring grow to 2 weeks old, digest with proteinase K at 55°C, and extract the genome DNA of the mouse tail with phenolic extraction. Using rat genomic DNA as a template, primers were designed for the second exon of the Rag1 gene, the t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a construction method of an immunodeficiency rat animal model and an application. The method comprises the following steps of separately constructing sgRNA expression vectorsof the 2nd exon of a rat Rag 1, the 3rd exon of an Rag2 gene, and the 1st exon of the I12rg, through in vitro transcription expression, obtaining rats of which the Rag1 gene and the Rag2 gene are knocked out, obtaining rats of which the I12rg gene is knocked out, and performing hybridizing, so as to obtain the rats of which the Rag1, the Rag2 and the I12rg are all knocked out. The rats SD-RG constructed by the method have immunodeficiency phenotype, transplant of various tumors is convenient, quick growth is promoted, and the method can be widely applied to fields of a humanized animal model,stem cells and tumor research and the like.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a construction method and application of an immunodeficiency rat animal model based on gene knockout technology. Background technique [0002] Humanized animal models have rebuilt the human immune system in vivo, which can better simulate the microenvironment of human tumors, and have received more and more attention in the in vivo study of tumors. At present, humanized mouse models have been used in the screening of new anticancer drugs and the exploration of therapeutic methods (such as cell therapy and antibody therapy). Knockout of recombination activation genes (Recombination Activation Genes, Rag1 or Rag2) in mice can lead to obstacles to the genetic recombination of the immunoglobulin-encoding gene region of T cell receptors and B cells, resulting in severe immunodeficiency phenotype Il2rg in mice The gene encodes a transmembr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/113C12N5/10C12N15/90A01K67/027
Inventor 祝献民范国平
Owner EYECURE THERAPEUTICS INC JIANGSU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap