Rabies virus antibody quantitative detection kit as well as preparation method and detection method thereof

A technology for quantitative detection of rabies virus, applied in the field of rabies virus antibody quantitative detection kit and its preparation, can solve the problems of increased risk of rabies infection, potential safety hazards, insufficient protection, etc.

Active Publication Date: 2019-07-12
CHANGCHUN SR BIOLOGICAL TECH
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are great drawbacks in the qualitative detection of antibodies, and the detection results are not accurate enough. Even if the test results are positive, the neutralizing antibodies in the serum may not reach a titer of ≥0.5 international units (IU / ml), which is not sufficiently protective and increases The risk of rabies infection is increased, and there is a great potential safety hazard

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rabies virus antibody quantitative detection kit as well as preparation method and detection method thereof
  • Rabies virus antibody quantitative detection kit as well as preparation method and detection method thereof
  • Rabies virus antibody quantitative detection kit as well as preparation method and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Preparation and identification of rabies virus-like particles

[0066] (1) Extraction of viral genome

[0067] Rabies virus CTN-1 virus was inoculated into vero cells, and the virus liquid was collected 2 days after inoculation. According to Genbank's BABVCTN-1 strain genome sequence information (Accession NO.HQ317918.1), Primer5.0 software was used to design specific amplification G and M gene primers, primer sequences are shown in Table 1.

[0068] Table 1 Specific amplification primers for glycoprotein gene G and matrix protein M of rabies virus CTN-1 strain

[0069] serial number Primer name Sequence (5'-3') Restriction sites SEQ ID 3 CTNG-F CCC GAATTC ATGATTCCTCAAAGCTCTGTTGTTTG

EcoR I SEQ ID 4 CTNG-R TT TCTGCAG TTACAGCTTGGTCTCACCTCCG

Pst I SEQ ID 5 CTNM-F CCC CTCGAG ATGAACTTTCTACGCAAGATAGTGA

Xho I SEQ ID 6 CTNM-R CCC GGTACC CTATTCTAGGAGCAGGGAAGAGTC

Kpn I

[0070] Underli...

Embodiment 2

[0095] Preparation and identification of embodiment 2 rabies virus G protein monoclonal antibody

[0096](1) Select 5 female BALB / c mice aged 6-8 weeks, inject the aforementioned purified rabies virus G protein virus-like particles and the same amount of Freund's complete adjuvant emulsion into the mice, and inject 200 μl subcutaneously into each mouse . Two weeks later, the second immunization was carried out, and the mice were injected with rabies virus G protein virus-like particles and an equal amount of Freund's incomplete adjuvant emulsion, and the injection volume and method were the same as the first immunization. The third immunization was carried out two weeks after the second immunization, and the immunization method and virus injection volume were the same as the second immunization. Two weeks after the third immunization, when the serum ELISA titer reached 1:10000 or more after the tail-cut blood collection, the splenocytes and myeloma cells were removed at 6×10 ...

Embodiment 3

[0098] The preparation of embodiment 3 rabies virus antibody quantitative detection kit (colloidal gold)

[0099] (1) Preparation of sample pad

[0100] The purified rabies virus-like particles prepared in Example 1 were diluted to 1.0 mg / ml with 20 mM sodium tetraborate solution, containing 2% Tween-20, and sprayed on the glass cellulose membrane as a sample pad.

[0101] (2) Preparation of marker pads

[0102] With 0.2mol / L K 2 CO 3 After adjusting the pH value of the 25nm colloidal gold solution to 8.4, add the rabies virus-like particle monoclonal antibody to the colloidal gold solution with a protein concentration of 50 μg / ml after purification and rapid stirring And continue to stir for 30 minutes; add 10% BSA to a final concentration of 1%, stir for 30 minutes, centrifuge at 10,000r / min for 30 minutes, carefully suck off the supernatant, and the precipitate is the initially purified gold-labeled rabies virus-like particle. Cloning of antibody conjugates. Gold stand...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Protein concentrationaaaaaaaaaa
Densityaaaaaaaaaa
The average particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a rabies virus antibody quantitative detection kit as well as a preparation method and a detection method thereof, belongs to the technical field of antibody detection kits, and solves the problems that the antibody detection accuracy is not high enough and potential safety hazards exist in the prior art. The kit comprises an immunochromatographic detection test strip and asample diluent, the immunochromatographic detection test strip sequentially comprises a sample pad coated with a rabies virus antigen, a marker pad coated with a monoclonal antibody of the rabies virus antigen, a nitrocellulose membrane coated with a detection line and a quality control line and a water absorption pad from one end to the other end, and the sample pad, the marker pad, the nitrocellulose membrane and the water absorption pad are mutually stacked and attached to the upper surface of a back plate. According to the invention, the rabies virus antibody in blood is detected by adopting a competition method, and real antibody numerical values in a blood sample can be directly displayed according to a standard curve in combination with strip reading equipment, so that the detection accuracy and sensitivity are improved.

Description

technical field [0001] The invention relates to the technical field of antibody detection kits, in particular to a rabies virus antibody quantitative detection kit and a preparation method and detection method thereof. Background technique [0002] Rabies, commonly known as "mad dog disease", is the only acute infectious disease in humans with a fatality rate of 100%. Rabies is widespread worldwide. According to reports, the number of deaths caused by rabies in the world is estimated to be 40,000 to 70,000 each year. In recent years, the rabies epidemic in my country has been on the rise, and the number of deaths ranks first among the 37 legally notifiable infectious diseases in my country. In 1996, the number of reported cases of rabies nationwide was once low at 159 cases. In 2004, the number of reported cases of rabies nationwide rose to 2660 cases. In 2010, the number of officially confirmed rabies cases in China was 3300. Many species of mammals are associated with th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/68G01N33/558G01N33/532G01N33/533
CPCG01N33/56983G01N33/6854G01N33/558G01N33/532G01N33/533G01N2333/145
Inventor刘伟石晶殷玉和夏振强王慧慧崔玉梅丁秋雨赵玉环刘洪运王倩
OwnerCHANGCHUN SR BIOLOGICAL TECH