Eimeria tenella AN1-like Zinc finger domain-containing protein and application thereof in inhibiting invasion of coccidium
A technology of Eimeria and zinc finger protein, applied in the direction of immunoglobulin, immunoglobulin from serum, application, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 The acquisition of EtAN1-ZnFP gene and its functional analysis
[0037] Insect strain
[0038] The sporulated oocyst Shanghai strain of Eimeria tenella (resource number: CAAS21111601) was isolated and preserved by the protozoal disease innovation team of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
[0039] RNA extraction and cDNA preparation
[0040] Total RNA was extracted from unsporulated oocysts using TRIzol reagent (TaKaRa, Tokyo, Japan) according to the instruction manual. Total RNA concentration was determined at 260 nm using a spectrophotometer (Eppendorf, Hamburg, Germany). RNA quality was assessed by electrophoresis on a 1% agarose gel. Complementary DNA (cDNA) was synthesized from total RNA of unsporulated oocysts using Super Script III RT reagent.
[0041] amplify
[0042]The ORF sequence of the EtAN1-ZnFP gene was amplified using the upstream primer 5'-ATGAGCTCAGAGCAACACG-3' (SEQ ID NO.1) and the downstre...
Embodiment 2
[0046] Example 2 EtAN1-ZnFP expression and Western blot analysis
[0047] Use upstream primers 5′-GC with restriction enzyme sites BamHI and SalI (underlined) respectively GGATCC ATGAGCTCAGAGCAACACGAAAACGAAAGGCCTTCTGCTCCGCCCTTGTGTGCGAAGAACTGCGGCTT-3 (SEQ ID NO.5)' and downstream primer 5'-GC GTC GAC TCAAAGCTTCTGGAGTTTGTCTG-3' (SEQ ID NO. 6) was used to amplify the EtAN1-ZnFPORF sequence by PCR. The amplified fragment and the pGEX-4T-1 vector were digested with BamHI / SalI. The BamHI / SalI double-digested EtAN1-ZnFP fragment and the pGEX-4T-1 vector were recovered from agarose gel, and after ligation, the recombinant pGEX-4T-EtAN1-ZnFP plasmid was transformed into Escherichia coli BL21 (DE3) (Tiangen, China). Colonies with correct sequencing were expanded and cultured at 37°C, and 1.0 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma, St Louis , MO, USA) induced expression for 8h. The cells were lysed by ultrasonication in an ice bath, ultrasonication was performed fo...
Embodiment 3
[0049] Example 3 Preparation of rEtAN1-ZnFP antiserum
[0050] 200 μg of purified rEtAN1-ZnFP was emulsified with an equal volume of complete Freund's adjuvant (Sigma, St Louis, MO, USA) and injected subcutaneously into 2-month-old New Zealand white rabbits. Two weeks later, booster immunization was carried out, which was emulsified with Freund's incomplete adjuvant (Sigma, St Louis, MO, USA). Immunizations were performed every 7 days for a total of 5 immunizations. Seven days after the last immunization, blood was collected and polyclonal antibody serum was separated. Negative serum was isolated from blood collected from rabbit ear vein before immunization.
[0051] Fluorescent quantitative PCR
[0052] In order to detect the transcription level of EtAN1-ZnFP in different developmental stages of Eimeria tenella (unsporulated oocysts, sporulated oocysts, sporozoites, and second-generation merozoites), the RNA of four stages was extracted and removed. After genomics, the fi...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com