Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mycoplasma synoviae indirect ELISA detection kit

An indirect technology for mycoplasma synovium, applied in the field of rapid diagnosis of animal epidemic pathogens, can solve the problems of false positives and achieve rapid detection, good specificity, and rapid detection

Pending Publication Date: 2019-09-10
NINGXIA UNIVERSITY +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As an important detection method for the epidemiological investigation of Mycoplasma avium, ELISA is widely used in the detection and diagnosis of Mycoplasma avium because of its fast and convenient advantages. Certain false positives may occur when detecting Mycoplasma bursa, and there is no commercialized ELISA kit for Mycoplasma avium synovium in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycoplasma synoviae indirect ELISA detection kit
  • Mycoplasma synoviae indirect ELISA detection kit

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0051] The preparation method of the MSPB protein uses the nucleic acid of the Mycoplasma avulosa Ningxia isolate NX-7 as a template, uses designed and synthesized specific primers to carry out overlapping PCR amplification, and recovers the amplified PCR product.

[0052] The product sequence is shown in SEQ ID NO.1

Embodiment 1

[0084] Example 1: Preparation of coated antigen:

[0085] 1.1 Design and synthesis of specific primers: Four pairs of primers were designed according to the MSPB region in the whole gene sequence of Mycoplasma avium NX-7, with BamHI and wxya Restriction sites are expected to amplify a gene fragment with a size of 1398bp.

[0086] MSPB-F1 5' GCCGGATCCATGAAAAATAA 3'

[0087] MSPB-R1 5' GATTCATCTGTCCATTGGAATG 3'

[0088] MSPB-F2 5' CATTCCAATGGACAGATGAATC 3'

[0089] MSPB-R2 5' ATTTTTCTCTAGCTTTGGTCCAAG 3'

[0090] MSPB-F3 5' CTTGGACCAAAGCTAGAGAAAAAT 3'

[0091] MSPB-R3 5' ATAAACCCGTCCCAGTATAGTGT 3'

[0092] MSPB-F4 5' ACACTATACTGGGACGGGTTTAT 3'

[0093] MSPB-R4 5' CTTCTCGAGTTAATCTTCGTGAGT 3'

[0094] 1.2 Construction of pET30a-MSPB prokaryotic expression vector:

[0095] The MSPB gene fragment was amplified by Overlap using specific upstream and downstream primers, and the purified fragment and pET-30a vector were used to BamHI and wxya Restriction endonucleases (pu...

Embodiment 2

[0103] Embodiment 2: Indirect ELISA detects Mycoplasma avium bursa antibody

[0104] The purified recombinant protein MSPB from Example 1 was used as the coating antigen to establish an indirect ELISA method, and the optimal protein coating concentration and serum dilution concentration for ELISA, as well as the optimal reaction conditions for ELISA were explored by using the square array method. The final conditions are as follows:

[0105] 2.1 Coating: Dilute the antigen with carbonate buffer (pH=9.6), take 100 μL of the diluted solution and coat it on a 96-well microtiter plate, wrap it in plastic wrap, seal it well, incubate at 37°C for 1 hour, then overnight at 4°C, PBST Wash three times, 3 min each time.

[0106] 2.2 Blocking: Incubate with 1% skimmed milk powder diluted in PBST at 37°C for 1 hour, then overnight at 4°C, block with 100 μL / well, incubate at 37°C for 60 minutes, spin dry, wash three times with PBST, 3 minutes each time.

[0107] 2.3 Serum action conditio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a Mycoplasma synoviae indirect ELISA detection kit. The kit uses main membrane antigen MSPB recombinant protein amplified by a strain of Mycoplasma synoviae Ningxia isolate through overlapping PCR as a coating antigen. The kit is capable of rapidly, specifically and efficiently detecting mycoplasma synoviae, to monitor prevalence of Mycoplasma synoviae in chicken flocks.

Description

technical field [0001] The invention belongs to the field of rapid diagnosis of animal epidemic pathogens, in particular to a rapid serological diagnosis method for avian synovial mycoplasma. Background technique [0002] Mycoplasma synoviae (Mycoplasma synoviae, MS) is an important pathogenic microorganism that infects poultry and birds. It was first discovered in chickens by Olson and Wills in the United States in 1954. Mycoplasma synoviae is a kind that can cause poultry It is an important pathogenic microorganism with a high infection rate that can cause various diseases with birds, which can cause arthritis, bursitis and tenosynovitis, respiratory tract and air bag infections, etc. in birds and birds. Mixed infection of Mycoplasma hydras and various viruses, bacteria, and parasites. In September 1980, Li Yueting isolated the avian synovial sac for the first time from a group of 70-85-day-old chicks showing symptoms of lameness and joint swelling in Wuzhou, Guangxi, my cou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/531
CPCG01N33/569G01N33/531Y02A50/30
Inventor 李继东何生虎司朵朵郭亚男魏晓明郭磊
Owner NINGXIA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com