Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene with triglyceride (TAG) synthesis function and construction method and application thereof

A triglyceride, gene technology, applied in microorganism-based methods, applications, genetic engineering, etc., can solve the problems of high cost, inability to meet, poor versatility, etc.

Pending Publication Date: 2019-10-08
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are many problems in the production of glyceride-type PUFA by esterase, such as low enzyme recovery rate, high cost, low product yield, poor versatility, etc. (Sun et al., 2015). In addition, the esterase method cannot meet the current requirements. Increasing demand for "pure natural plant extraction" and "individual customization"

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene with triglyceride (TAG) synthesis function and construction method and application thereof
  • Gene with triglyceride (TAG) synthesis function and construction method and application thereof
  • Gene with triglyceride (TAG) synthesis function and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning and Analysis of NoDGAT2 Gene

[0043] The NoDGAT2J and 2K genes and their flanking sequences were respectively cloned from the gDNA and cDNA of Nannochloropsis IMET1 by PCR technology, and the primers used were designed according to the data recorded in the literature of Li et al, 2014, and the required enzymes were introduced at both ends of the primers The cut site was handed over to Shanghai Sangong for synthesis:

[0044] 1) NoDGAT2J-for:

[0045] 5'GGTACCACATAATGGCTCACCTCTT 3';

[0046] 2) NoDGAT2J-rev:

[0047] 5'GAATTCTCAAGAGATCGCAACGAAC3';

[0048] 3) NoDGAT2K-for:

[0049] 5'AAGCTTACATAATGTTGCTGGCGTCGT 3';

[0050] 4) NoDGAT2K-rev:

[0051] 5'GAATTCTCAGACGATGCGAAGCGTC 3';

[0052] The PCR machine used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL dNTP (2.5 mM each, TAKARA), 2 μL each of forward and reverse primers (10 μM), 5 μL 10×buffer (Mg2 + plus, TAKARA), 0.4 μL rTaq enzyme (5U / μL, TAKARA),...

Embodiment 2

[0055] Example 2: Overexpression of NoDGAT2 in Nannochloropsis marine IMET1

[0056] (1) Construction of endogenous overexpression vector

[0057] see figure 2 . The specific method of constructing the vector is as follows: by PCR method (the same as the PCR conditions of Example 1), with the pMD18-T vector of NoDGAT2J or 2K as a template, according to the following two sets of primers, i.e. one group is 1) and 2), The other group is 3) and 4) respectively amplified to obtain the full-length ORF fragments of NoDGAT2J or 2K. In order to construct the cloning, with the help of the primer introduction method, a restriction site and a protective base are added to the 5' end of the target sequence, and a restriction site is added to its 3' end. The primer sequence is as follows:

[0058] 1) NoDGAT2J-oe-for:

[0059] 5' CCGCTCGAGATGGCTCACCTCTTC 3';

[0060] 2) NoDGAT2J-oe-rev:

[0061] 5'GGGGAATTCTCAAGAGATCGCAACG 3';

[0062] 3) NoDGAT2K-oe-for:

[0063] 5' CCGCTCGAGATGTTGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology. The invention relates to a gene with a triglyceride synthesis function and a construction method thereof and an application thereof for rationally regulating contents of oil-producing microalgae triglyceride and polyunsaturated fatty acid. The gene is: 1) a base sequence shown as SEQ ID NO: 1 or 2; or 2) a DNA sequence of the protein encoding the same biological function and having 95% or more homology with the nucleic acid sequence defined by a sequence 1 or 2 in a sequence table. The full-length gene and the amino acid sequence as nannochloropsis are firstly reported, and the members of the DGAT gene family can be enriched; overexpression of the above gene can significantly improve the ability of nannochloropsis to synthesize TAG,and the application value in using genetic engineering to improve the production of TAG in organisms can be improved; in addition, overexpression of the above gene can increase the specific PUFA content in the TAG, and therefore the method has the potential to increase the yield of a high value-added compound of microalgae.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene with triglyceride (TAG) synthesis function, its construction method and its application in rationally regulating the content of triglyceride and polyunsaturated fatty acid in oil-producing microalgae. Background technique [0002] Polyunsaturated fatty acids (PUFA) are an important class of compounds for maintaining human health. Most PUFAs are essential fatty acids, which cannot be directly synthesized by the human body and can only be ingested from the outside world (Kwak et al., 2012). Among them, linoleic acid (C18:2, LA) has the effect of lowering blood fat and softening blood vessels, and has the reputation of "vascular scavenger"; linolenic acid (C18:3) can enhance intelligence, protect eyesight, and improve sleep; Eicosapentaenoic acid (C20:4) is a bioactive substance of many circulating eicosanic acid derivatives, which has an important regulatory effect on l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12N1/12C12P7/64C12R1/89
CPCC12N9/1029C12P7/6463C12P7/6472C12Y203/01158
Inventor 辛一徐健
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI