Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene with triglyceride (TAG) synthesis function and construction method and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A triglyceride, gene technology, applied in microorganism-based methods, applications, genetic engineering, etc., can solve the problems of high cost, inability to meet, poor versatility, etc.
Pending Publication Date: 2019-10-08
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF7 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, there are many problems in the production of glyceride-type PUFA by esterase, such as low enzymerecovery rate, high cost, low product yield, poor versatility, etc. (Sun et al., 2015). In addition, the esterase method cannot meet the current requirements. Increasing demand for "pure natural plant extraction" and "individual customization"
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0042] Example 1: Cloning and Analysis of NoDGAT2 Gene
[0043] The NoDGAT2J and 2K genes and their flanking sequences were respectively cloned from the gDNA and cDNA of Nannochloropsis IMET1 by PCR technology, and the primers used were designed according to the data recorded in the literature of Li et al, 2014, and the required enzymes were introduced at both ends of the primers The cut site was handed over to Shanghai Sangong for synthesis:
[0044] 1) NoDGAT2J-for:
[0045] 5'GGTACCACATAATGGCTCACCTCTT 3';
[0046] 2) NoDGAT2J-rev:
[0047] 5'GAATTCTCAAGAGATCGCAACGAAC3';
[0048] 3) NoDGAT2K-for:
[0049] 5'AAGCTTACATAATGTTGCTGGCGTCGT 3';
[0050] 4) NoDGAT2K-rev:
[0051] 5'GAATTCTCAGACGATGCGAAGCGTC 3';
[0052] The PCR machine used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL dNTP (2.5 mM each, TAKARA), 2 μL each of forward and reverse primers (10 μM), 5 μL 10×buffer (Mg2 + plus, TAKARA), 0.4 μL rTaq enzyme (5U / μL, TAKARA),...
Embodiment 2
[0055] Example 2: Overexpression of NoDGAT2 in Nannochloropsis marine IMET1
[0056] (1) Construction of endogenous overexpression vector
[0057] see figure 2 . The specific method of constructing the vector is as follows: by PCR method (the same as the PCR conditions of Example 1), with the pMD18-T vector of NoDGAT2J or 2K as a template, according to the following two sets of primers, i.e. one group is 1) and 2), The other group is 3) and 4) respectively amplified to obtain the full-length ORF fragments of NoDGAT2J or 2K. In order to construct the cloning, with the help of the primer introduction method, a restriction site and a protective base are added to the 5' end of the target sequence, and a restriction site is added to its 3' end. The primer sequence is as follows:
[0058] 1) NoDGAT2J-oe-for:
[0059] 5' CCGCTCGAGATGGCTCACCTCTTC 3';
[0060] 2) NoDGAT2J-oe-rev:
[0061] 5'GGGGAATTCTCAAGAGATCGCAACG 3';
[0062] 3) NoDGAT2K-oe-for:
[0063] 5' CCGCTCGAGATGTTGC...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention belongs to the technical field of biology. The invention relates to a gene with a triglyceride synthesis function and a construction method thereof and an application thereof for rationally regulating contents of oil-producing microalgae triglyceride and polyunsaturated fatty acid. The gene is: 1) a base sequence shown as SEQ ID NO: 1 or 2; or 2) a DNA sequence of the protein encoding the same biological function and having 95% or more homology with the nucleic acid sequence defined by a sequence 1 or 2 in a sequence table. The full-length gene and the amino acid sequence as nannochloropsis are firstly reported, and the members of the DGAT gene family can be enriched; overexpression of the above gene can significantly improve the ability of nannochloropsis to synthesize TAG,and the application value in using genetic engineering to improve the production of TAG in organisms can be improved; in addition, overexpression of the above gene can increase the specific PUFA content in the TAG, and therefore the method has the potential to increase the yield of a high value-added compound of microalgae.
Description
technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene with triglyceride (TAG) synthesis function, its construction method and its application in rationally regulating the content of triglyceride and polyunsaturated fatty acid in oil-producing microalgae. Background technique [0002] Polyunsaturated fatty acids (PUFA) are an important class of compounds for maintaining human health. Most PUFAs are essential fatty acids, which cannot be directly synthesized by the human body and can only be ingested from the outside world (Kwak et al., 2012). Among them, linoleic acid (C18:2, LA) has the effect of lowering blood fat and softening blood vessels, and has the reputation of "vascular scavenger"; linolenic acid (C18:3) can enhance intelligence, protect eyesight, and improve sleep; Eicosapentaenoic acid (C20:4) is a bioactive substance of many circulating eicosanic acid derivatives, which has an important regulatory effect on l...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
