Chromosome long segment insertion detection method and long segment insert detection method based on MassARRAY platform

A detection method and long-fragment technology, applied in the biological field, can solve the problems of low cost, low throughput and accuracy, and achieve the effects of low consumption, reduced false positive results, and high sensitivity

Active Publication Date: 2019-10-08
JIANGSU SIMCERE MEDICAL DEVICE CO LTD +2
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method belongs to qualitative detection, simple operation and low cost, but the throughput and accuracy are low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chromosome long segment insertion detection method and long segment insert detection method based on MassARRAY platform
  • Chromosome long segment insertion detection method and long segment insert detection method based on MassARRAY platform
  • Chromosome long segment insertion detection method and long segment insert detection method based on MassARRAY platform

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] Taking the ACE gene rs4646994 as an example, rs4646994-F is a shared forward primer, rs4646994-R1 is a wild-type reverse primer, and rs4646994-R2 is an insertion-type reverse primer; the wild-type and insertion-type single-base extension primers are the same.

[0131] Table 1 PCR primer sequences

[0132] PCR_ID PCR_SEQ rs4646994-F ACGTTGGACTGGAGACCACTCCCATCCTTT rs4646994-R1 ACGTTGATGTGGCCATCACATTCGTCAGAT rs4646994-R2 ACGTTGATTGAGACCATCCCGGCTAAAACG

[0133] Table 2 Sequences of single-base extension primers

[0134] SNP_ID UEP_SEQ rs4646994 GACCTGCTGCCTATACAGTCACTTTTT

[0135] 1. gDNA extraction: Initial peripheral blood input volume was 200 μl, extracted with QIAamp DNA Mini Kit, and eluted with 50 μl TB;

[0136] One oropharyngeal sampler, wipe the mouth 40 times, use Hi-Swab DNA Kit to extract, and 50 μl TB to elute;

[0137] 2. PCR process

[0138] (1) Dilute the sample to 10ng / μl;

[0139] (2) Prepare ...

experiment example

[0184] This experimental example mainly verifies the accuracy, specificity, sensitivity and precision of the double-hole detection method applied in the present invention.

[0185] The accuracy verification scheme of this experimental example: 20 cases were detected at each site, and compared with Sanger sequencing, the expected target was 95%.

[0186] The specific verification scheme of this experimental example: Included in the accuracy, the expected target is 95%.

[0187] The sensitivity verification scheme of this experiment example: included in the accuracy, the expected target is 95%.

[0188] The precision verification scheme of this experimental example (including intra-batch, inter-batch, and personnel comparison, not involving inter-instrument comparison) is shown in Table 6 below:

[0189] Intra-batch precision: each sample was repeated 3 times in the same batch to compare the intra-batch precision;

[0190] Batch-to-batch precision: the same operator tests the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chromosome long segment insertion detection method and a long segment insertion detection method based on a MassARRAY platform, and relates to the technical field of biology.The detection method includes the steps: simultaneously identifying whether samples to be detected are wild and / or mutant by a first detection unit; identifying whether the samples to be detected aremutant or not by a second detection unit; reading and discriminating identification results of the first detection unit and identification results of the second detection unit; judging whether chromosome long segments are inserted into the samples to be detected or not. By the aid of the additional arranged second detection unit, chromosome long segment insertion can be effectively detected according to the identification results of the first detection unit and the second detection unit, false negative results are effectively decreased, and false positive results can be effectively decreased.Besides, the chromosome long segment insertion detection method has the advantage that types of the samples to be detected can be expanded.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting long-segment insertion of chromosomes and a method for detecting long-segment insertion based on a MassARRAY platform. Background technique [0002] Insertions of longer chromosomal segments have been associated with disease development and differences in drug metabolism. When there is a longer fragment insertion in the target sequence, due to competition or PCR preference, etc., when co-amplification is achieved in the same system, the amplification efficiency of the longer fragment (mutant type) containing the insertion sequence is lower than that without the insertion A shorter fragment of the sequence (wild type). When the sample type is heterozygous, due to the difference in the amplification efficiency of the two strands, the heterozygous cannot detect the longer fragment containing the inserted sequence and is falsely reported as the homozygous wild typ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6872C12Q1/6883
CPCC12Q1/6872C12Q1/6883C12Q2600/156C12Q2600/16C12Q2531/113C12Q2533/101C12Q2537/143
Inventor陈珊珊肖念清李杜衡李小方赵妍李翔任用
OwnerJIANGSU SIMCERE MEDICAL DEVICE CO LTD