Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing biological mutant library

A construction method and mutant technology, applied in the field of biological mutant library construction, can solve the problems of high cost in the transgenic process, difficulty in obtaining a large number of plants, and low efficiency

Pending Publication Date: 2019-11-05
QINGDAO KINGAGROOT CHEM COMPOUNDS CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The cost and inefficiency of the transgenic process makes it difficult to obtain a large number of plants capable of producing progeny with different types of edits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing biological mutant library
  • Method for constructing biological mutant library
  • Method for constructing biological mutant library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Construction of a knockout vector for the Arabidopsis ALS gene, whose Cas9 gene is specifically expressed in egg cells.

[0057] Among them, the target is ttgccgatgatcccgagtgg , Arabidopsis thaliana ALS gene DNA is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:2.

[0058] DNA fragment 5' ttgccgatgatcccgagtgg 3' cloned into the pHEE401E vector {reference (1) Xing H L, Dong L, Wang Z P, et al.A CRISPR / Cas9toolkit for multiplex genome editing inplants[J].BMC Plant Biology,2014,14(1):327.( 2) Wang Z P, Xing H L, Dong L, et al. Egg cell-specific promoter-controlled CRISPR / Cas9 efficiently generate shomozygous mutants for multiple target genes in Arabidopsis in a single generation [J]. Genome Biology, 2015,16(1):144 The sgRNA expression cassette in .} was transformed into Agrobacterium GV3101 for transformation of Arabidopsis by flower dipping method.

Embodiment 2

[0059] Example 2. Transforming Arabidopsis {methods and materials used in this part, refer to (3) Chen Y, Wang Z, NiH, Xu Y, Chen Q, Jiang L.2017. CRISPR / Cas9-mediated base-editing systemefficiently generates gain-of-function mutations in Arabidopsis. Science China Life Sciences 60,520-523.}

[0060] After the constructed vector was transformed into the Agrobacterium GV3101 strain by the freeze-thaw method, the bacteria solution was applied to the YEP solid medium (containing kanamycin and gentamycin) by streaking method, and kept in a dark environment at 28°C. After culturing for 36-48 hours, a single colony was picked and inoculated into 1 ml of liquid YEB medium to which kanamycin and gentamycin had been added, and cultured overnight with shaking (28° C., 200 rpm). Carry out bacterium colony PCR identification at this moment, and select wherein positive clone, join in the 50ml Erlenmeyer flask, add 25mlYEP liquid culture medium (containing kanamycin and gentamycin), shake c...

Embodiment 3

[0061] Example 3. Identification of the genotype of the T1 generation plants

[0062] The editing type of the ALS gene was determined by PCR product sequencing and hygromycin resistance screening, and the plants (magic seed plants) with T-DNA and unedited ALS gene were isolated.

[0063] like figure 1 As shown, there are two types of egg cells produced by transgenic plants, the ratio is 1:1, the first genotype is containing T-DNA (that is, the elements required to complete the site-directed mutation target DNA can be expressed in the transgenic organism DNA fragment), due to the specific expression characteristics of egg cells, the target gene on the genome will be edited (that is, a mutation occurs), the second genotype does not contain T-DNA, so the target gene on the genome has not been edited, Still wild type. There are also two genotypes of pollen, the ratio is 1:1. The first genotype contains T-DNA. Due to the specific expression characteristics of egg cells, the targe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a biological mutant library. The method for constructing the biological mutant library comprises the steps that (1) a DNA fragment is introduced intoa target organism to obtain a genetically modified organism; the DNA fragment can express a desired element for completing site-directed mutagenesis of target DNA in the genetically modified organism;and (2) the genetically modified organism is cultured to obtain the biological mutant library; and the organism is a sexual reproductive organism, and the genetically modified organism can specifically perform site-directed mutagenesis on the target DNA in a germ cell. By using the biological mutant library obtained by the method, organisms with the following traits such as resistance to biotic stress, resistance to abiotic stress, high yield, good quality traits and high secondary metabolite yield can be screened, and therefore, the method for constructing the biological mutant library has great application prospects.

Description

technical field [0001] The invention relates to a method for constructing a biological mutant library in the technical field of bioengineering. Background technique [0002] Gene editing technology, especially CRISPR / Cas9 technology, has achieved precise gene editing in biological cells. The technical principle is to combine a guide RNA (sgRNA or gRNA) with a DNA endonuclease (such as Cas9, Cpf1, etc.) to form an RNA-protein complex (RNP for short), which can be searched on the genome and guide RNA. Complementary target sequence, so that the DNA endonuclease can precisely cut the bound DNA in this region. According to the characteristics of different DNA endonucleases, the results of shearing are various, which can be double-strand DNA breaks (DSB) with blunt ends or cohesive ends, or single-strand DNA breaks (Nick). The repair of DSBs or Nicks by organisms will lead to insertions or deletions (Indels), thereby achieving precise editing of the target gene. [0003] At pre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00
CPCC07K14/415C12N15/8261C12N15/82C12N15/00C12N15/85
Inventor 姜临建
Owner QINGDAO KINGAGROOT CHEM COMPOUNDS CO LTD