Method for constructing biological mutant library
A construction method and mutant technology, applied in the field of biological mutant library construction, can solve the problems of high cost in the transgenic process, difficulty in obtaining a large number of plants, and low efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1. Construction of a knockout vector for the Arabidopsis ALS gene, whose Cas9 gene is specifically expressed in egg cells.
[0057] Among them, the target is ttgccgatgatcccgagtgg , Arabidopsis thaliana ALS gene DNA is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:2.
[0058] DNA fragment 5' ttgccgatgatcccgagtgg 3' cloned into the pHEE401E vector {reference (1) Xing H L, Dong L, Wang Z P, et al.A CRISPR / Cas9toolkit for multiplex genome editing inplants[J].BMC Plant Biology,2014,14(1):327.( 2) Wang Z P, Xing H L, Dong L, et al. Egg cell-specific promoter-controlled CRISPR / Cas9 efficiently generate shomozygous mutants for multiple target genes in Arabidopsis in a single generation [J]. Genome Biology, 2015,16(1):144 The sgRNA expression cassette in .} was transformed into Agrobacterium GV3101 for transformation of Arabidopsis by flower dipping method.
Embodiment 2
[0059] Example 2. Transforming Arabidopsis {methods and materials used in this part, refer to (3) Chen Y, Wang Z, NiH, Xu Y, Chen Q, Jiang L.2017. CRISPR / Cas9-mediated base-editing systemefficiently generates gain-of-function mutations in Arabidopsis. Science China Life Sciences 60,520-523.}
[0060] After the constructed vector was transformed into the Agrobacterium GV3101 strain by the freeze-thaw method, the bacteria solution was applied to the YEP solid medium (containing kanamycin and gentamycin) by streaking method, and kept in a dark environment at 28°C. After culturing for 36-48 hours, a single colony was picked and inoculated into 1 ml of liquid YEB medium to which kanamycin and gentamycin had been added, and cultured overnight with shaking (28° C., 200 rpm). Carry out bacterium colony PCR identification at this moment, and select wherein positive clone, join in the 50ml Erlenmeyer flask, add 25mlYEP liquid culture medium (containing kanamycin and gentamycin), shake c...
Embodiment 3
[0061] Example 3. Identification of the genotype of the T1 generation plants
[0062] The editing type of the ALS gene was determined by PCR product sequencing and hygromycin resistance screening, and the plants (magic seed plants) with T-DNA and unedited ALS gene were isolated.
[0063] like figure 1 As shown, there are two types of egg cells produced by transgenic plants, the ratio is 1:1, the first genotype is containing T-DNA (that is, the elements required to complete the site-directed mutation target DNA can be expressed in the transgenic organism DNA fragment), due to the specific expression characteristics of egg cells, the target gene on the genome will be edited (that is, a mutation occurs), the second genotype does not contain T-DNA, so the target gene on the genome has not been edited, Still wild type. There are also two genotypes of pollen, the ratio is 1:1. The first genotype contains T-DNA. Due to the specific expression characteristics of egg cells, the targe...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com