Application of ornithine cyclohexanase in improving yield of ibuprofen A produced by bacillus amylolyticus
A technology of amylolytic spores and iturin, applied in the field of genes and biological fermentation, to achieve the effect of increasing yield and yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Construction of engineering strain LX-12 / pHY-ocd containing ornithine cyclohexylase plasmid:
[0024] 1. Design primers (ocd-F and ocd-R); use Corynebacterium glutamicum ATCC 13032 genomic DNA as a template to amplify the ocd gene sequence (1761bp) including the enzyme cleavage site;
[0025] ocd-F: CGGAATCCCTCCCTGCTGTGGAGGGAACCA
[0026] ocd-R:GCTCTAGACTTCGTCTTCCTTGCCGGTGCT;
[0027] The ocd gene sequence is shown in SEQ ID NO.1.
[0028] 2. Use EocRI and XbaI restriction endonucleases to double-enzyme digest the target gene fragment to obtain a gene fragment (1759bp). (4870bp); Wherein, the restriction endonuclease EocRI and XbaI restriction endonuclease are purchased from Beijing Quanshijin Biotechnology Co., Ltd.;
[0029] 3. The digested gene fragment and the linearized plasmid fragment were subjected to T 4 DNA ligase was connected to obtain the ligated product; the ligated product was transformed into Escherichia coli DH5α by the calcium chloride transformati...
Embodiment 2
[0034] Application of ornithine cyclohexylase in improving the production of iturin A by Bacillus amyloliquefaciens:
[0035] In this embodiment, for different fermentation medium formulations, the iturin A-producing ability of the engineering strain LX-12 / pHY-ocd was investigated (also inoculated with Bacillus amyloliquefaciens LX-12 in these 18 mediums at the same time) / pHY300 as a contrast), 18 groups of medium formulations are specifically shown in Table 1:
[0036] Table 1 Different fermentation medium formula pH6.9~7.2
[0037]
[0038]
[0039] The specific steps for obtaining the seed solution are as follows: first activate Bacillus amyloliquefaciens, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 250r / min and 37°C for 12 hours, and then activate The bacterium solution was inoculated in the fermentation medium in Table 1 with a volume percentage of 1% inoculum, and cultivated for 12 hours at 250r / min and 37°C to obtain a see...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com