Fluorescent RT-PCR primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus

A technology of RT-PCR and avian influenza virus, which is applied in the field of fluorescent RT-PCR primers, can solve the problems of not being able to identify highly pathogenic H7N9 strains, and achieve the effect of ensuring public health safety and protecting production safety

Pending Publication Date: 2019-12-13
GONGBEI CUSTOMS TECH CENT
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods can only detect classical H7N9 viruses, but cannot identify highly pathogenic H7N9 strains that are more threatening to poultry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent RT-PCR primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus
  • Fluorescent RT-PCR primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus
  • Fluorescent RT-PCR primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0044] Preparation of positive control: Submit the target fragment to BGI for gene synthesis, and make recombinant plasmid WHC183644-75 as a positive control. The sequence of the target fragment is as follows:

[0045] CTATCAACTTAAATTGTTGGTTGGTTTTTGCTATAAGCCGGTTTAATTTCCCTGTTATTTGATTAATTGCCGATTGAGTGCTTTTGTAATCTGCAGCAGTTCCCTCTCCCTGTGCATTCTGGTGTCTGAAACCATACCAACCATCAATTAGGCCTTCCCATCCATTTTCAATGAAACCCGCTATAGCACCAAATAGGCCTCTCGCAGTCCGTTTTCCCTTTGGAACCTCAGGAACATTCTTCATCCCTGTTGCCAGCAGAAGACTCCTTTGCTTAACATATCTCGGACATTTTCCAACTGCCCTGCTATCTATGTTCTGAAATGGCAAGT(SEQ ID NO:4)。

[0046] Preparation of negative control: SPF chicken embryo allantoic fluid was aseptically taken, and viral nucleic acids such as common influenza A virus, IBDV, IBV and NDV were tested, and the results were all negative, which was used as a negative control.

Embodiment 1

[0047] Example 1 Primers and Probes

[0048] After screening a large number of designed primers and probes, it was found that primers 75F, 75R and probe 75P had the best effect in detecting HP-H7N9 by RT-PCR, and their base sequences are shown below.

[0049] Table 1 Fluorescent RT-PCR primers and probes for highly pathogenic H7N9 avian influenza virus

[0050]

Embodiment 2

[0051] Example 2 Viral RNA Extraction

[0052] (1) Take n sterilized 1.5mL Eppendorf tubes and number them, where n is the sum of the tested sample, positive control and negative control (positive control and negative control are marked in the kit).

[0053] (2) Add 600 μL of lysate to each tube, add 200 μL each of the tested sample, negative control, and positive control, and then add 200 μL of chloroform, shake and mix on the mixer for 5 seconds (not too strong, so as not to produce an emulsified layer, you can also use Mix by hand inversion). Centrifuge at 4°C, 12 000r / min for 15min.

[0054] (3) Take the same number of sterilized 1.5mL Eppendorf tubes as in step (1), add 400 μL of isopropanol (pre-cooled at -20°C), and mark it. Pipette the supernatant from each tube in step (2) of this standard and transfer it to the corresponding tube. The supernatant should be pipetted at least 500 μL, and the middle layer cannot be suctioned out. Invert and mix well.

[0055] (4) Cen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent RT-PCR primer, probe and method for detecting a highly pathogenic H7N9 avian influenza virus (HP-H7N9). The established HP-H7N9 fluorescent RT-PCR detection method can specifically detect the HP-H7N9, and no cross reactions appear with a low pathogenicity H7N9 influenza virus (LP-H7N9), H7N3 influenza virus, H3N2 influenza virus, H5N1 avian influenza virus, H5subtype avian influenza virus (Re-6 vaccine strain), H5 subtype avian influenza virus (Re-8 vaccine strain), H9 subtype avian influenza virus, influenza A (H1N1) virus (H1N1), infectious bursal disease virus (IBDV), chicken infectious bronchitis virus (IBV), newcastle disease virus (NDV) and the like; positive plasmids with the lowest concentration of 7.09 copies / [mu]L can be detected; the variable coefficient (CV) value of a repeatability test is between 1.97% and 4.89%, the method is indicated to have good repeatability. The established HP-H7N9 fluorescent RT-PCR method has the advantages of specificity, sensitivity, rapidness and good repeatability, and is a good method for rapidly detecting HP-H7N9.

Description

technical field [0001] The invention relates to a fluorescent RT-PCR primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus. Background technique [0002] Influenza A (H7N9) virus is a subtype of avian influenza virus, which originally belonged to low pathogenicity influenza virus and was only found and spread in birds. The virus has a low lethality rate to poultry and birds, and has the ability to infect humans after gene exchange. The onset period of human infection with H7N9 is short, and the severity rate and mortality rate are slightly higher than those of SARS. [0003] At the end of March 2013, human cases of H7N9 avian influenza virus first appeared in Shanghai and Anhui. The H7N9 influenza virus gene comes from the genetic reassortment of wild birds in East Asia and chicken flocks in Shanghai, Zhejiang, and Jiangsu, China. The hemagglutinin protein (HA) gene of this virus is genetically different from the HA gene of other H7 subtype vi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2563/107C12Q2521/107C12Q2561/101
Inventor陈轩黄海超杨素沙才华赵福振邵建宏
OwnerGONGBEI CUSTOMS TECH CENT