A kind of lanthipeptide precursor peptide amya6 and its preparation method and application
A technology of lanthione and precursor peptide, applied in the process of improving the antibacterial activity of Bacillus amyloliquefaciens metabolites, the field of lanthione precursor peptide amyA6 and its preparation, can solve the problem of harming other animals, plants, human health and the environment Pollution and other issues, to achieve the effect of low production cost, high yield, and enhanced antibacterial activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Source and screening process of lanthipeptide precursor peptide amyA6
[0032] The lanthipeptide precursor peptide amyA6 gene is derived from Bacillus amyloliquefaciens S499.
[0033] The whole genome of Bacillus amyloliquefaciens S499 was extracted using TIANGEN Bacterial Genomic DNA Extraction Kit.
[0034] Use Primer 5.0 to design lanthipeptide precursor peptide amyA6 primers, and add homologous fragments at both ends of pET-28a as homology arms at both ends of the precursor peptide sequence (A6-S: CTTTAAGAAGGAGATATACCATGAAAAAGAACTTCAGCGCG, SEQID NO: 3; A6-A: CCTTTCGGGCTTTGTTATACTTGCCTTTGCGGAC, SEQ ID NO: 4).
[0035] PCR amplification of lanthipeptide precursor peptide amyA6 gene fragment. The PCR reaction uses the genomic DNA of Bacillus amyloliquefaciens S499 as a template, primers A6-S and A6-A as upstream and downstream primers, and uses KOD-Plus polymerase to amplify, and PCR amplifies to obtain the lanthipeptide precursor peptide amyA6 gene fragme...
Embodiment 2
[0038] Example 2 Escherichia coli heterologous expression
[0039] (1) Construction of precursor peptide gene expression vector
[0040] Precursor peptide primers and pET-28a vector sequence-specific primers were designed using Primer 5.0, and homologous fragments at both ends of the precursor peptide sequence were added as homology arms. The precursor peptide gene fragment and the pET-28a vector fragment were amplified by PCR, and the PCR amplification product was verified by 1% agarose gel electrophoresis, and the target band was recovered by using the Axygen gel recovery kit. The purified precursor peptide gene fragment and the pET-28a vector fragment were ligated using the ligase in the Vazyme kit to construct a recombinant vector. The recombinant vector was transformed into Escherichia coli BL21(DE3) by means of heat shock transformation.
[0041] (2) Acquisition of induced expression of precursor peptide protein
[0042]The precursor peptide protein is obtained by mea...
Embodiment 3
[0046] The application of the lanthipeptide precursor peptide amyA6 in the process of improving the antibacterial activity of the metabolites of Bacillus amyloliquefaciens comprises the following steps:
[0047] (1) Fermentation of Bacillus amyloliquefaciens:
[0048] Experimental group: Cultivate (ferment) Bacillus amyloliquefaciens in liquid NB medium for 12 hours to the logarithmic growth phase, take out the shaker, add 0.001-10mg / L lanthipeptide precursor peptide amyA6 to the fermentation broth, and continue fermentation Cultivate, collect the supernatant by centrifugation after 24 hours (supernatant 1);
[0049] Control group: Cultivate (ferment) Bacillus amyloliquefaciens in liquid NB medium for 12 hours to the logarithmic growth phase, take out the shaker at the same time as the experimental group, do not add the lanthipeptide precursor peptide amyA6, and continue the fermentation culture, after 24 hours The supernatant was collected by centrifugation (supernatant 2). ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More