Application of Tea Tree Glycosyltransferase Gene ugt91q2 in Improving Plant Cold Resistance
A technology of glycosyltransferase and cold resistance, which is applied in the field of genetic engineering, can solve problems such as overwintering difficulties, and achieve the effect of improving frost resistance and reducing cold resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Cloning of embodiment 1 UGT91Q2
[0018] 1. Acquisition of cDNA template: After the fresh leaves of tea leaves were treated with liquid nitrogen and ground, they were extracted with a commercial plant RNA extraction kit, and then reverse-transcribed with a commercial reverse transcription kit to obtain cDNA.
[0019] PCR primer sequences:
[0020] UGT91Q2F: GGTTCCGCGTGGATCCATGAACGGTGACTCCCAACAACA (SEQ ID No. 2) UGT91Q2R: GGCCGCTCGAGTCGACTTAAGGGTGCTTACAAGCTTTGATTACCTCCAAC (SEQ ID No. 3)
[0021] reaction system:
[0022]
[0023] Reaction procedure:
[0024]
[0025] 2. Construction of recombinant plasmid pGEX4T1-UGT91Q2
[0026] The complete pGEX4T1 vector was subjected to double enzyme digestion as required to obtain a linear vector, and then the vector was recovered through a commercial kit gel to obtain a purified linear vector. Use ligase to connect a single target gene with a linear vector to construct a recombinant plasmid pGEX4T1-UGT91Q2, and then trans...
Embodiment 2
[0027] Embodiment 2 tea tree low temperature stress
[0028] The tea tree was treated with low temperature stress, and the expression level of UGT91Q2 gene in the low temperature transcriptome of tea tree was detected. The result is as figure 1 shown.
[0029] figure 1 It is the expression level change of UGT91Q2 gene in the low-temperature transcriptome of tea plants, NA is the control (tea seedlings grown under normal conditions); CS is the low-temperature treatment at 4°C for 6 hours; CA is the low-temperature treatment at 4°C for 7 days; FA is the low-temperature treatment at 0°C Treated for 7 days; DA was treated at a low temperature of 25°C for 7 days; through the expression of the gene under different low temperature conditions, it can be concluded that the gene is strongly induced at low temperature and plays a certain role.
[0030] figure 2 It is the change trend of UGT91Q2 gene and cold-responsive transcription factor CBF gene in different tea tree genotypes, a...
Embodiment 3
[0031] Embodiment 3 tea tree (model plant) gene silencing method:
[0032] (1) Design antisense oligonucleotide primers: use the website http: / / sfold.wadsworth.org / cgi-bin / index.pl to design antisense oligonucleotide primers for specific genes;
[0033] (2) Select and synthesize specific primers: find the gene-specific antisense oligonucleotide primer sequence through the comparison of the tea tree genome database http: / / tpia.teaplant.org / index.html, and send it to the company for synthesis; primer sequence: TGATGCCGGCTTTGGCTAGG (SEQ ID No. 4)
[0034] (3) Primer dilution: the final primer concentration is 20uM, and RNA-Free H 2 O dilution;
[0035] (4) Select the sample to be silenced (healthy complete plant);
[0036] (5) Silent method:
[0037] Injection: Select a complete annual plant with good growth and buds, treat it in the dark for 15 minutes, draw out the diluted 20uM primer solution with a 1mL syringe, gently rub the back of the first and second leaves of the pla...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More