Application of rice gene OsATL15 in regulating absorption and transport of pesticides

A rice and genetic technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of loss, low utilization efficiency and decline of chemical fertilizers and pesticides, and achieve the effect of reducing the amount of use

Active Publication Date: 2020-02-21
SOUTH CHINA AGRI UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This means that more than 99.9% of pesticides will enter the environment, the use efficiency of chemical fertilizers and pesticides is low, and most of them are lost into the soil and rivers, resulting in the decline of soil quality, water pollution and soil ecological diversity (Pimentel et al., 1992)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice gene OsATL15 in regulating absorption and transport of pesticides
  • Application of rice gene OsATL15 in regulating absorption and transport of pesticides
  • Application of rice gene OsATL15 in regulating absorption and transport of pesticides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Cloning of embodiment 1 OsATL15 gene and its encoded protein

[0058] The RNA (OMEGA R6827-01) of the wild-type japonica rice variety Zhonghua 11 seedlings was extracted, reverse-transcribed (Takara cat#6210A) to obtain gDNA-free cDNA (with the nucleotide shown in SEQ ID NO: 1), and its As a template, PCR amplification was performed using forward primer F1 and reverse primer R1. A PCR product of 1896bp was obtained.

[0059] After sequencing, the 1896bp PCR product has the nucleotide shown in SEQ ID NO:2. Use (http: / / web.expasy.org / translate / ) to perform amino acid translation on the coding sequence CDS, and obtain the amino acid sequence of OsATL15, which encodes 631 amino acids. The encoded protein is named OsATL15, and the amino acid sequence of the protein is shown in SEQ ID NO:3.

[0060] F1: 5'-ATGGCAGATCAGAAGGTG-3';

[0061] R1: 5'-TCATAGGTGACGAGACTGAGGTG-3'.

Embodiment 2

[0062] Example 2 Construction of Overexpressed OsATL15 Plants

[0063] 1. Overexpression of OsATL15 gene

[0064] 1. Construction of recombinant expression vector pCAMBIA1300-35S-OsATL15

[0065] Extract the RNA of wild-type Zhonghua 11 seedlings, reverse transcribe to obtain cDNA as a template (extraction and reverse transcription methods are the same as in Example 1), use primer 1 (ACCCGGGGATCCTCTAGAGTCGAATGGCAGATCAGAAGGTG) and primer 2 (ATGATACGAACGAAAGCTCTGCATCATAGGTGACGAGACTGAGGTG) to carry out PCR amplification (Takara cat #R045), the reaction conditions are: 1 cycle: 98°C, 3min; 32 cycles: 98°C, 30s, 58°C, 30s, 72°C, 1min; 1 cycle: 72°C, 5min; 15-base homologous recombination arm of the OsATL15 gene.

[0066] The above PCR products were gel-recovered, and homologously recombined with the pCAMBIA2300-35S vector backbone (provided by Wuhan Boyuan Company) that had been digested with Sal I and Pst I through the In-fusion kit (Takara cat#639648) to obtain recombinant pla...

Embodiment 3

[0095] Example 3: CRISPR knockout construction of OsATL15 mutant plants

[0096] 1. Use the CRISPR / Cas9 system to select the target sequence according to the exon sequence of OsATL15

[0097] Using the simple and efficient CRISPR / Cas9 system, select the specific target sequence according to the OsATL15 exon sequence, the target sequence: GAGGCACGTCCTGGAGAAGGAGG. The target sequence is aimed at the OsATL15 gene and specifically inactivates the OsATL15 protein.

[0098] 2. Construct the pCRISPR / Cas9 recombinant vector containing the above target sequence fragment

[0099] 1) According to the target sequence, design adapter primers with sticky ends

[0100] Add the designed target sequence to the specific sticky end adapter (F: GGCA; R: AAAC) of the pCRISPR / Cas9 system, and synthesize the complete adapter primer.

[0101] F3: 5'-GGCA-GAGGCACGTCCTGGAGAAGG-3';

[0102] R3: 5'-AAAC-CCTTTCTCCAGGACGTGCCTC-3'.

[0103] 2) Annealing the adapter primer with sticky ends to complement...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of rice gene OsATL15 in regulating absorption and transport of pesticides. According to the invention, the gene OsATL15 capable of regulating and controlling absorption and transport of pesticides is obtained by performing separating and cloning on a rice variety Zhonghua 11. A protein encoded by a nucleotide sequence of the gene OsATL15 and a recombinant vector, expression box, transgenic cell line and recombinant bacterium which contain the gene OsATL15 can improve absorption and transport of pesticides in rice, so that the pesticides can reach parts damaged by pests, and the usage amount of the pesticides in rice field is reduced. The gene OsATL15 also can genetically improve conduction of pesticides in rice varieties to select rice varieties withhigh-efficiency use of pesticides. Moreover, the OsATL15 gene can precipitate in regulating plant height and has an effect of improving rice germplasm resources.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and particularly relates to the application of rice gene OsATL15 in regulating the absorption and transport of pesticides. Background technique [0002] Rice is the main food crop in my country and the whole world. About 2.2 billion people in the world depend on rice, and 60% of China's population depends on rice. However, the excessive use of pesticides in rice production has caused enormous pressure on the ecological environment. It is estimated that in the current use of pesticides, only 2% of the applied pesticides will actually stay on the plant surface, and only 0.1% will actually reach the target (Wang et al., 2007). This means that more than 99.9% of pesticides will enter the environment, the use efficiency of chemical fertilizers and pesticides is low, and most of them are lost into the soil and rivers, resulting in the decline of soil quality, water pollution and soil ecologica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46C12Q1/6895C12N15/11
CPCC07K14/415C12N15/8261C12N15/8286C12Q1/6895C12Q2600/13
Inventor 徐汉虹肖钰艳林菲张汉林李志伟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap