Methyltransferase and application thereof

A methyltransferase and methyltransferase technology, applied in methyltransferase and its application field, can solve the problems of flavonoid oxygen-methyltransferase not being cloned and identified, etc.

Active Publication Date: 2020-02-21
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, there are still some potential flavonoid oxygen-methyltransferases that have not been cloned and identified, and it is necessary to conduct further research in this field to find enzymes with more application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methyltransferase and application thereof
  • Methyltransferase and application thereof
  • Methyltransferase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0173] Embodiment 1, the isolation of methyltransferase and its coding gene

[0174] The inventors cloned 31 full-length cDNA sequences from soybean.

[0175] Soybean RNA was extracted and reverse-transcribed to obtain soybean cDNA. Carry out PCR amplification with this cDNA as template, use wherein primer pair 1 (SEQ ID NO:3,4); Primer pair 2 (SEQ ID NO:9,10); Primer pair 3 (SEQ ID NO:13,14) Primer pair 4 (SEQ ID NO:17,18); Primer pair 5 (SEQ ID NO:27,28); Primer pair 6 (SEQ ID NO:31,32); Primer pair 7 (SEQ ID NO:35, 36); Primer pair 8 (SEQ ID NO:39,40); Primer pair 9 (SEQ ID NO:43,44); Primer pair 10 (SEQ ID NO:51,52); Primer pair 11 (SEQ ID NO: 55,56); primer pair 12 (SEQ ID NO:59,60); primer pair 13 (SEQ ID NO:63,64); primer pair 15 (SEQ ID NO:71,72); primer pair 16 (SEQ ID NO: NO:75,76); Primer pair 17 (SEQ ID NO:81,82); Primer pair 18 (SEQ ID NO:91,92); Primer pair 19 (SEQ ID NO:95,96); Primer pair 20 ( SEQ ID NO:99, 100); primer pair 21 (SEQ ID NO: 103, 104); primer...

Embodiment 2

[0229] Embodiment 2, the construction of the Escherichia coli recombinant expression vector of methyltransferase gene GMOMT3

[0230] The plasmid GMOMT3-pMD18T containing the GMOMT3 gene constructed in Example 1 was used as a template to amplify the target gene.

[0231] The forward primer used by GMOMT3 is the 1-20 nucleotide sequence of the GMOMT3 gene, and the pGEX4T-1 homology arm sequence is added to the 5' end: GATCTGGTTCCGCGTGGATCC; the reverse primer used by GMOMT3 is the last 20 nucleotide sequence of the GMOMT3 gene , and the pGEX4T-1 homology arm sequence: GTCACGATGCGGCCGCTCGAG was added to the 5' end.

[0232] The above primers and templates were used to amplify the GMOMT3 gene by PCR method. The DNA polymerase was the high-fidelity Primer Star DNA polymerase from Treasure Bioengineering Co., Ltd., and the PCR program was set by referring to its manual: 98°C for 2min; 98°C for 15s, 58°C for 15s, 72°C for 1.2min, a total of 35 cycles; 72°C 5min at ℃; keep warm at ...

Embodiment 3

[0233] Embodiment 3, the expression of methyltransferase gene GMOMT3 in Escherichia coli

[0234] The Escherichia coli expression vector GMOMT3-pGEX4T-1 constructed in Example 2 was transformed into commercially available E.coliBL21. Inoculate a recombinant into LB medium, cultivate to OD at 37°C 200rpm 600 About 0.6-0.8, the bacterial liquid was cooled to 4°C, and IPTG with a final concentration of 200 μM was added, and the expression was induced at 18°C ​​at 110 rpm for 18 hours. The bacteria were collected by centrifugation at 4°C, the cells were lysed with 50mM Tris-HCl, pH8.0 buffer, the supernatant of the cell lysate was collected by centrifugation at 12000g at 4°C, and samples were taken for SDS-PAGE electrophoresis. Compared with the pGEX4T-1 empty vector recombinant, the GMOMT3-pGEX4T-1 recombinant had a distinct band (approximately 65KD) characterizing GST-GMOMT3. From the results of Western Blot, it also proved that the target protein GST-GMOMT3 was soluble expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to methyltransferase and application thereof and discloses a group of methyltransferase obtained by latest separation and identification. In the case of providing a methyl donor,the enzyme disclosed by the invention can transfer methyl to a flavonoid or isoflavone compound to add one methyl group for the flavonoid or isoflavone compound. Specifically, the methyltransferase disclosed by the invention is capable of specifically and efficiently catalyzing methylation of hydroxyl groups at C-3, C-7, C-3' and C-4' of a flavonoid compound substrate or methylation of hydroxyl groups at C-7 and C-4' of an isoflavone compound substrate. The methyltransferase can be applied to the fields of synthesis, transformation, bioconversion and the like of the flavonoid or isoflavone compounds.

Description

technical field [0001] The invention relates to the fields of biotechnology and natural product medicine; specifically, the invention relates to a group of methyltransferases and their applications. Background technique [0002] In the large family of plant natural products, flavonoids have always been a category that people have paid more attention to. As active ingredients in Chinese herbal medicine, flavonoids have various functions such as anti-cancer, anti-inflammation, anti-oxidative damage, anti-pathogenic bacterial infection, and protection of the cardiovascular system. More than 10,000 natural flavonoids have been identified so far, mainly found in various vegetables, fruits, plant stems and seeds. [0003] In the post-modification of flavonoids, hydroxylation is the most basic type, which usually occurs on the carbon atoms at the 3, 5, 6, 7, 3’, 4’, 5’ positions of the backbone. Different numbers and sites of hydroxylation are important reasons for the diversity ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12P17/06
CPCC12N9/1007C12P17/06Y02P20/55
Inventor周志华李晓东严兴蒋雨果王平平赵文芳
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI