Application of soybean seed-specific promoter
A soybean seed-specific technology, applied in the field of plant genetic engineering, can solve the problem of few or not many specific promoters, and achieve the effect of improving seed quality and yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1 Relative expression identification of soybean oleosin gene transcription level
[0032] 1. Extraction of total RNA from soybean tissues (including roots, stems, young leaves, old leaves, flowers, immature seeds, mature seeds, young pods and old pods, etc.)
[0033] Refer to TAKARA RNAiso Plus Kit
[0034] Take an appropriate amount of the above-mentioned soybean tissue samples, grind them thoroughly, and continuously add liquid nitrogen until the samples become powdery; quickly transfer the powder to a 1.5ml liquid nitrogen pre-cooled EP tube, add 1ml RNAiso Plus extract, mix well, and store at room temperature Let stand for more than 5 minutes, centrifuge at 12000g 4°C for 5min, transfer the supernatant to a new 1.5ml EP tube, add 1 / 5 volume of chloroform, shake and emulsify vigorously, let stand at room temperature for 5min, centrifuge at 12000g 4°C for 15min, transfer the supernatant to a new tube Add an equal volume of isopropanol to a 1.5ml EP tube, i...
Embodiment 2
[0045] Example 2 Acquisition, functional identification and application of seed-specific promoter
[0046] 1. Cloning of seed-specific promoters
[0047] The total DNA of soybeans (variety "Nannong 99-10" from the National Soybean Improvement Center) was extracted by SDS method, primers were designed to amplify the target promoter sequence (SEQ NO.1), and SalⅠ and BamHI restriction sites were added, The amplification primers are: Forward: 5'GTCGACTTCTATTCAGGAGGTGGTTG 3', Reverse: 5'GGATCCGAGTTTTGAGTGAAGAGTGAG 3'. The size of the amplified sequence is 1601bp.
[0048] The cloned product was connected to a T vector (purchased from PROMEGA), and a single colony was picked and shaken, and the plasmid was extracted and sequenced to verify that the promoter sequence was correct. The correct plasmid and PBI101 vector (purchased from Biovector Science Lab) verified by sequencing were double-digested with SalI and BamHI restriction endonucleases, and the target fragment recovered fro...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com