Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of soybean seed-specific promoter

A soybean seed-specific technology, applied in the field of plant genetic engineering, can solve the problem of few or not many specific promoters, and achieve the effect of improving seed quality and yield

Inactive Publication Date: 2020-03-13
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, people have obtained various types of promoters from plants or from outside sources, but there are relatively few seed-specific promoters that are effective for transgenic economic crops, especially in the soybean field. Compared with other crops The number of seed-specific promoters is even less in terms of application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean seed-specific promoter
  • Application of soybean seed-specific promoter
  • Application of soybean seed-specific promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Relative expression identification of soybean oleosin gene transcription level

[0032] 1. Extraction of total RNA from soybean tissues (including roots, stems, young leaves, old leaves, flowers, immature seeds, mature seeds, young pods and old pods, etc.)

[0033] Refer to TAKARA RNAiso Plus Kit

[0034] Take an appropriate amount of the above-mentioned soybean tissue samples, grind them thoroughly, and continuously add liquid nitrogen until the samples become powdery; quickly transfer the powder to a 1.5ml liquid nitrogen pre-cooled EP tube, add 1ml RNAiso Plus extract, mix well, and store at room temperature Let stand for more than 5 minutes, centrifuge at 12000g 4°C for 5min, transfer the supernatant to a new 1.5ml EP tube, add 1 / 5 volume of chloroform, shake and emulsify vigorously, let stand at room temperature for 5min, centrifuge at 12000g 4°C for 15min, transfer the supernatant to a new tube Add an equal volume of isopropanol to a 1.5ml EP tube, i...

Embodiment 2

[0045] Example 2 Acquisition, functional identification and application of seed-specific promoter

[0046] 1. Cloning of seed-specific promoters

[0047] The total DNA of soybeans (variety "Nannong 99-10" from the National Soybean Improvement Center) was extracted by SDS method, primers were designed to amplify the target promoter sequence (SEQ NO.1), and SalⅠ and BamHI restriction sites were added, The amplification primers are: Forward: 5'GTCGACTTCTATTCAGGAGGTGGTTG 3', Reverse: 5'GGATCCGAGTTTTGAGTGAAGAGTGAG 3'. The size of the amplified sequence is 1601bp.

[0048] The cloned product was connected to a T vector (purchased from PROMEGA), and a single colony was picked and shaken, and the plasmid was extracted and sequenced to verify that the promoter sequence was correct. The correct plasmid and PBI101 vector (purchased from Biovector Science Lab) verified by sequencing were double-digested with SalI and BamHI restriction endonucleases, and the target fragment recovered fro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a soybean seed-specific promoter, belongs to the field of biotechnology, and relates to the application field of changing the seed quality and yield of cash crops. The seed-specific promoter sequence of the invention is as described in SEQ ID NO.1, and the promoter is cloned and specifically expressed in Arabidopsis thaliana seeds. Through promoter predictive analysis, about 2000bp upstream sequences of the soybean oleosin gene are isolated, and the amplified fragment and a pBI101 vector containing a GUS reporter gene are recombined. The function of Arabidopsis thaliana transgene is verified by an Agrobacterium tumefaciens inflorescence infection method, and it is proved that the seed-specific promoter could positively regulate the expression of theoleosin gene, thus providing a favorable tool for improving the seed quality and yield of crops.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of a soybean seed-specific promoter. Background technique [0002] Breeding high-oil and high-quality varieties is one of the important goals of oil crop production. Compared with traditional breeding, molecular genetic breeding, which has emerged with the development of genetic engineering technology, has the advantages of faster, more efficient, and more accurate. Further improving the quality and yield of seed crops has become a hot spot in agricultural scientific research. [0003] The expression regulation of plant genes is mainly carried out at the transcriptional level, which is coordinated by a variety of cis-acting elements and trans-acting factors, and plant gene promoters are important cis-acting elements. In general, the target gene can be expressed under the control of a complete strong promoter, and different types of promoters h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/20
CPCC12N15/8205C12N15/8234C12N15/8245C12N15/8247C12N15/8251
Inventor 沈悦陈志德沈一刘永惠
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com