Application of bacillus licheniformis without leucine dehydrogenase gene in heterologous protein production
A technology of Bacillus licheniformis and leucine dehydrogenase, applied in application, genetic engineering, plant gene improvement, etc., to achieve the effect of improving protein expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Obtaining of Bacillus licheniformis WX-02Δbcd with deletion of leucine dehydrogenase (bcd) gene:
[0025] 1. According to the bcd gene sequence in the Bacillus licheniformis WX-02 genomic DNA sequence, design the upstream homology arm primers (bcd-F1, bcd-R1) and downstream homology arm primers (bcd-F2, bcd-R2) of the bcd gene and using the genomic DNA of Bacillus licheniformis WX-02 as a template, carry out PCR amplification with the upstream homology arm primer and the downstream homology arm primer of the bcd gene respectively to obtain the upstream homology arm fragment of the bcd gene and the downstream homology arm fragment of the bcd gene Source arm fragment (the upstream homology arm fragment of bcd gene is 567bp; the downstream homology arm fragment of bcd gene is 591bp);
[0026] Wherein, the sequences of bcd-F1, bcd-R1, bcd-F2, bcd-R2 are:
[0027] bcd-F1:GATCTTTTCTACGAGCTCCACGTGCTGTCACATGTAGCA,
[0028] bcd-R1: TAGAGAATAGGGGTTATGATTTTACATTTTTTTATTCCTCCTCAT...
Embodiment 2
[0045] Construction of three foreign protein expression vectors:
[0046] Preparation of alkaline protease free expression plasmid pHY-AprE:
[0047] 1. With Bacillus licheniformis WX-02 genome DNA as template, design primer AprE-F / AprE-R to amplify the gene expression frame of alkaline protease gene aprE (shown in SEQ ID NO.2, comprise promoter, aprE gene and terminator) to obtain aprE gene sequence 1740bp;
[0048] 2. Using EcoRI and XbaI to digest the obtained aprE gene to obtain double-digested fragments;
[0049] 3. Using EcoRI and XbaI to perform double digestion on the Bacillus expression vector pHY300PLK to obtain the double digestion vector fragment;
[0050] 4. Ligate the double-digestion fragment and the double-digestion vector obtained in steps 2 and 3 with T4 DNA ligase to obtain the ligation product; transfer the ligation product into E. Under certain conditions, the medium containing tetracycline resistance was screened to obtain transformants, and the plasmi...
Embodiment 3
[0070] Construction and application of three kinds of genetically engineered bacteria expressing foreign proteins:
[0071] The alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker, and the neutral protease free expression vector pHY-NprE were electrotransformed into Bacillus licheniformis WX-02Δbcd, using tetracycline resistance as a selection marker, and After colony PCR screening, using pHY-F and pHY-R as verification primers, PCR verification obtained positive transformants, and obtained the alkaline protease expression strain Bacillus licheniformis WX-02Δbcd / pHY-AprE, and the keratinase expression strain Bacillus licheniformis WX- 02Δbcd / pHY-Ker, neutral protease expression strain Bacillus licheniformis WX-02Δbcd / pHY-NprE;
[0072] In this example, the free expression plasmid pHY-AprE of alkaline protease, the free expression vector pHY-Ker of keratinase, and the free expression vector pHY-NprE of neutral protease were respecti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



