Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SiRNA (small interference Ribonucleic Acid) for targeted inhibition on expression of esophagus cancer EGFL6 gene, constructed expression vector and application

A technology of gene expression and RNA interference, which is applied in the fields of biomedicine and molecular biology, can solve the problems of difficult and convincing cell experiments, achieve the effect of small immune response and improve transfection efficiency

Pending Publication Date: 2020-04-03
SHANXI MEDICAL UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] In order to more accurately explain the relationship between the EGFL6 gene and tumor development, simple cell experiments are difficult to be convincing, so in vitro methods are needed for further verification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRNA (small interference Ribonucleic Acid) for targeted inhibition on expression of esophagus cancer EGFL6 gene, constructed expression vector and application
  • SiRNA (small interference Ribonucleic Acid) for targeted inhibition on expression of esophagus cancer EGFL6 gene, constructed expression vector and application
  • SiRNA (small interference Ribonucleic Acid) for targeted inhibition on expression of esophagus cancer EGFL6 gene, constructed expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Designing an siRNA sequence that targets and inhibits the expression of the EGFL6 gene in esophageal cancer cells.

[0041] According to the mRNA sequence of EGFL6 gene in esophageal cancer cells (NM_015507.4), 3 groups of siRNA sequences targeting EGFL6 gene expression and control siRNA sequences were designed, and one siRNA sequence with the best interference effect was screened out, named siEGFL6. The specific siRNA sequence is as follows, wherein siEGFL6 is an effective interference fragment group, and siNC is a negative control group.

[0042] si EGFL6:5'-GGAAGCUACUACUGCAAAUTT-3';

[0043] 5' — AUUUGCAGUAGUAGCUUCCTT — 3'.

[0044] si NC: 5' — UUCUCCGAACGUGUCACGUTT — 3';

[0045] 5' — ACGUGACACGUUCGGAGAATT — 3'.

[0046] Through in vitro transfection of esophageal cancer cell lines, the above-mentioned sequences with the highest transfection efficiency were selected by Real-time PCR and Western-blot methods. The sequence can effectively inhibit the ex...

Embodiment 2

[0047] Example 2: Design and synthesis of oligonucleotides: The sense strand and antisense strand of shRNA were designed and synthesized with the siRNA sequence designed in Example 1. The Loop structure in the shRNA is selected from "c TCAAGAGA" and "TCTCTTGAg", and Age I and EcoR I restriction sites are added to the 5' end, respectively, and the sequence is synthesized by Invitrogen. The specific shRNA sequence is as follows:

[0048] pLK sh EGFL6-1 (sense strand): 5'-CCGG GGAAGCUACUACUGCAAAUTTTTCAAGAGAUAAACGUCAUCGAAGGAA TTTTTTT GGTACC-3';

[0049] pLK sh EGFL6-2 (antisense strand): 5'-AATT GGTACC AAAAAA TTCCUUCGAUGAUGACGUUUATCTCTTGAA AAATTGCAGTAGTAGCTTCC-3';

[0050] pLK sh control—1 (sense strand): 5'-CCGG UUCUCCGAACGUGUCACGUTT TTCAAGAGAAATTCTCCGAACGTGTCACGT TTTTTTT GGTACC—3';

[0051] pLK sh control—2 (antisense strand): 5'-AATT GGTACC AAAAAA ACGUGACACGUUCGGAGAATTTCTCTTGAA AAACGTGACACGTTCGGAGAA-3'.

[0052] The EGFL6 lentiviral packaging vector constructed by pLK sh EGFL...

Embodiment 3

[0054] Example 3: Construction of an interference lentiviral vector that targets and inhibits the expression of esophageal cancer EGFL6 gene: a schematic diagram of the structure of the lentiviral vector pLKO.1 puro is shown in figure 1 shown. The vector contains a U6 promoter, which can continuously promote the expression of downstream genes in host cells and continuously express small interfering RNAs with interfering effects. The vector also contains a CMV promoter, which can drive the expression of fluorescent protein EGFP, which is convenient for the detection of transfection efficiency and infection efficiency.

[0055] The lentiviral vector pLKO.1 puro was double-digested with Age I and EcoR I to linearize it. After gel purification and recovery, the annealed product obtained in Example 2 was ligated with T4 ligase overnight at 16°C, and transformed into competent bacteria. Recombination-positive clones were taken, and after transformation and screening, they were sent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biomedicines and molecular biology and relates to siRNA (small interference Ribonucleic Acid) for targeted inhibition on expression of an esophagus cancer EGFL6 gene, and an RNA interference recombinant lentiviral vector for the targeted inhibition on the expression of the esophagus cancer EGFL6 gene. The constructed RNA interference recombinant lentiviral vector is used to inhibit the expression of the esophagus cancer EGFL6 gene and effectively inhibit the expression of the esophagus cancer EGFL6 gene. The siRNA has double strands and is markedas si EGFL6; a deactivated lentiviral vector is used to carry a DNA (Deoxyribonucleic Acid) template of a UCP2 RNA interference segment, and is transcribed into shRNA (small hairpin RNA) in vivo, sothat the problems of targeting ability, safety and expression continuity of RNA interference are perfectly solved. A target gene is integrated to a target cell genome, is expressed for long time and has a small immune response, so that the siRNA is a relatively ideal interference vector which is introduced into tumor cells and is used for silencing the EGFL6 gene in the tumor cell.

Description

technical field [0001] The invention belongs to the technical fields of biomedicine and molecular biology, and specifically relates to an siRNA for targeting and inhibiting the expression of EGFL6 gene in esophageal cancer, a constructed expression vector and application thereof. Background technique [0002] The morbidity and mortality of tumors in today's society are getting higher and higher. Due to the strong aggressiveness and easy metastasis of tumors, most patients are already in the middle and late stages when they go to the doctor, and the curative effects of surgery, radiotherapy and chemotherapy are limited. The growth, development and metastasis of tumors depend on the formation of new blood vessels. At present, the most specific angiogenic factor is endothelial growth factor (vascular endothelial growth factor, VEGF), and a variety of anti-angiogenic drugs have been developed for VEGF, among which the most widely used The anti-angiogenic drug is bevacizumab, whi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867A61K31/713A61P35/00
CPCC12N15/1135C12N15/86A61K31/713A61P35/00C12N2310/141C12N2740/15043
Inventor 王艳红亢晶王娟娟田继华藏好晶杨佳王桂琴常思佳冀贺
Owner SHANXI MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com