Supercharge Your Innovation With Domain-Expert AI Agents!

Ubiquitin ligase gene OsNLA2, protein and application of ubiquitin ligase gene OsNLA2 in rice selection

A technology of ubiquitin ligase and gene, applied in the direction of ligase, application, genetic engineering, etc., can solve the problems of rice seed and plant growth and development without any research

Active Publication Date: 2020-05-19
武汉艾迪晶生物科技有限公司
View PDF24 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above results show that E3 ubiquitin ligase NLA has a great influence on plant adversity, stress and phosphorus balance, but there is no research on the growth and development of rice seeds and plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ubiquitin ligase gene OsNLA2, protein and application of ubiquitin ligase gene OsNLA2 in rice selection
  • Ubiquitin ligase gene OsNLA2, protein and application of ubiquitin ligase gene OsNLA2 in rice selection
  • Ubiquitin ligase gene OsNLA2, protein and application of ubiquitin ligase gene OsNLA2 in rice selection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Construction of OsNLA2 Gene Overexpression Plants

[0063] Extract the RNA of rice Zhonghua 11 and reverse transcribe it into cDNA, using the primer pair:

[0064] F3: 5'-atggtaccatgaagttcggtgcaatatatgaa-3'(KpnI), SEQ ID NO.3;

[0065] R3: 5'-atggatccaattcccattgacagcatagcctg-3' (BamHI), SEQ ID NO.4;

[0066] After the cDNA of the OsNLA2 gene was amplified by PCR, the overexpression vector OsNLA2-p1306 of the OsNLA2 gene was constructed by connecting (KpnI and BamHI) into the pCAMBIA-1306 vector (the pCAMBIA-1306 vector was purchased from Cambia Company). Agrobacterium EHA105 was used to mediate The method of genetic transformation, the overexpression vector was introduced into the normal rice variety Zhonghua 11.

[0067] Transplant all the obtained transgenic seedlings into baskets with soil, water and fertilize them regularly, and plant them in the field when the seedlings grow about 10cm in height. After the seedlings grow up, extract genomic DNA and ...

Embodiment 2

[0077] Construction of embodiment 2 OsNLA2 gene mutant plant

[0078] Using a single target sequence:

[0079] F6: tgttaagtctgcacctcctgagg, SEQ ID NO.9;

[0080] Using the above-mentioned single target sequence, the gene knockout vector OsNLA2-C of the OsNLA2 gene was constructed (for the method refer to Ma X et al, A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants.Mol Plant.2015 , 8(8):1274-1284). The genetic transformation method mediated by Agrobacterium EHA105 was used to introduce the gene knockout expression vector into the normal japonica rice variety Zhonghua 11. The mutant plants were sequenced in the T0 generation, and it was determined that the gene had been knocked out in three lines ( figure 2 ), continue to propagate independently to the T1 generation, and obtain an independent mutant plant line of the OsNLA2 gene. The seed size of the OsNLA2 gene mutant plants was significantly smaller than th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a ubiquitin ligase gene OsNLA2, a protein and application of the ubiquitin ligase gene OsNLA2 in rice selection. The protein encoded by the ubiquitin ligase gene OsNLA2 has anamino acid sequence shown as SEQ ID NO. 1, and a cDNA sequence shown as SEQ ID NO. 2. Through construction of rice plants with gene OsNLA2 expression and rice plants with gene OsNLA2 mutation, it is found that gene OsNLA2 expression can be improved so as to have grain sizes and 1000-grain weights of normal rice grains increased; and moreover, rice plant heights in low-nitrogen environment can alsobe increased. In addition, the gene OsNLA2 expression can be knocked-out so as to have quantities and weights of normal individual rice plants increased. Therefore, the gene OsNLA2 can be used for improving rice grain types, 1000-grain weights and rice plant heights in low-nitrogen environment in the process of rice selection; and moreover, the gene OsNLA2 can also be used for improving rice yield in the process of rice selection. In addition, the gene OsNLA2 is also of important application values in the aspects of plant seed size, weight, yield, low-nitrogen-environment plant height increase and the like.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically refers to an ubiquitin ligase gene OsNLA2, a protein and its application in rice breeding. Background technique [0002] Ubiquitination is a type of protein post-translational modification, which is involved in many aspects of plant stress and growth and development. The ubiquitination process involves ubiquitin ligases, ubiquitin activating enzymes and ubiquitin conjugating enzymes. E3 ubiquitin ligase plays a very important role in the ubiquitination pathway, which is responsible for the specific recognition of protein substrates and the recruitment and transport of 76 amino acid ubiquitin molecules to lysine residues of protein substrates ( Deshaies R J, Joazeiro C A. RING domain E3ubiquitin ligases [J]. Annual Review of Biochemistry, 2009, 78(1): 399-434.). E3 ubiquitin ligases determine the specificity of ubiquitinated substrates, and the RING type plays an importa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H5/10A01H5/04A01H6/46
CPCC12N9/93C12N15/8218C12N15/8261C12Y603/02019
Inventor 方中明王高华段芳
Owner 武汉艾迪晶生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More