Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel coronavirus antigen colloidal gold diagnostic kit

A diagnostic kit, coronavirus technology, applied in the directions of viruses/phages, viruses, viral peptides, etc., can solve the problem of the lack of binding force of the new coronavirus, and achieve the effect of effective control of the epidemic, simple and fast test operation, and accurate diagnosis.

Pending Publication Date: 2020-06-16
SICHUAN MACCURA BIOTECH CO LTD
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, studies have shown that public studies have tested three currently published polyclonal antibodies against the RBD region of SARS-CoV. Cloned antibody has no binding ability at all in the new coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronavirus antigen colloidal gold diagnostic kit
  • Novel coronavirus antigen colloidal gold diagnostic kit
  • Novel coronavirus antigen colloidal gold diagnostic kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] This embodiment provides a SARS-COV2 spike protein antibody, which is a paired antibody to the S1 region of the SARS-COV2 spike protein, prepared by the following method:

[0043] 1. Expression and purification of SARS-COV2 spike protein

[0044] (1) fully synthesize the gene encoding the Gln14-Arg685 region of the S1 protein;

[0045](2) The S1 gene was cloned between the IL2 secretion signal peptide of the eukaryotic expression vector pMFcIg (ABLINK biotech) and the mouse Fc (mFc, including hinge-CH2-CH3) tag gene to form the S1-mFc fusion gene, and the cloned The forward primer used is: CAGTGTGTTAATCTTACAACC, and the reverse primer is: ACGTGCCCGCCGAGGAGAATT;

[0046] (3) Transfer the S1-mFc expression plasmid to the competent cell Rosseta, pick the positive single clone, and extract the plasmid after amplification;

[0047] (4) Use 293Fectin (thermofisher) transfection reagent to transfect S1-mFc expression plasmid into 293F cells, continue to culture in serum-free...

Embodiment 2

[0060] This embodiment provides a SARS-COV2 spike protein antibody colloidal gold diagnostic kit, including the paired antibody to the S1 region of the SARS-COV2 spike protein prepared in Example 1, prepared by the following method:

[0061] (1) Take a 0.01% chloroauric acid aqueous solution and heat it to boiling, add dropwise a volume concentration of 1% trisodium citrate solution and keep stirring, and continue to boil for 15 minutes after the chloroauric acid aqueous solution changes from golden yellow to purple. , after cooling, restore to the original volume with distilled water, and store at 2°C to 8°C for later use;

[0062] (2) Concentrate the paired antibody solution of the S1 region of the SARS-COV2 spike protein to 1 mg / mL, transfer it into a dialysis bag, and dialyze it with a Tris buffer with a concentration of 20 mmol / L and a pH value of 7.0 at 2°C to 8°C overnight;

[0063] (3) Add an equal volume of colloidal gold to the paired antibody of the S1 region of th...

Embodiment 3

[0065] The SARS-COV2 spike protein antibody colloidal gold prepared by the method of Example 2 is clinically verified.

[0066] Take 7 clinically confirmed cases of new coronavirus pneumonia, 10 suspected samples and 10 negative samples for verification. The verification method is as follows:

[0067] Add SARS-COV2 spike protein antibody colloidal gold to a 96-well plate, add 100 μL of the above-mentioned different types of specimens, incubate at 37°C for 1 hour, wash the plate, add primary antibody against another S antigen epitope, and incubate at 37°C for 1 hour Finally, wash the plate, then add the enzyme-labeled secondary antibody against the Fc segment of human IgG, and develop the color with the chromogenic reagent, and the color development result is as follows: figure 1 , utilize a microplate reader to measure the OD value, the results are shown in Table 3, and figure 2 and image 3 Shown; Among them, Table 3 gives the figure 1 The order of adding samples and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SARS-COV2 fibrin antibody which is a pairing antibody of an S1 region of SARS-COV2 fibrin. The invention further discloses a preparation method of the SARS-COV2 fibrin antibody. The preparation method of the SARS-COV2 fibrin antibody comprises the following steps: expressing and purifying a gene of an S1 protein Gln14-Arg685 region based on SARS-COV2 to obtain a fusion protein, and then preparing a paired antibody from the fusion protein. The SARS-COV2 fibrin antibody is used for preparing a novel coronavirus detection kit, and the invention provides the novel coronavirus antigen colloidal gold diagnosis kit which comprises the SARS-COV2 fibrin antibody. The SARS-COV2 colloidal gold diagnostic kit provided by the invention is simple to operate, can quickly diagnose whether a patient is infected with SARS-COV2 or not, and is beneficial to effective control of epidemic situations.

Description

technical field [0001] The invention relates to the technical field of novel coronavirus pneumonia detection drugs, in particular to a novel coronavirus antigen colloidal gold diagnostic kit. Background technique [0002] The 2019 novel coronavirus (COVID-2019) was named by the World Health Organization on January 12, 2020. Coronaviruses are a large family of viruses known to cause colds as well as more serious illnesses such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). The novel coronavirus is a new strain of coronavirus that has never been found in humans before. [0003] Common signs after a person is infected with a coronavirus include respiratory symptoms, fever, cough, shortness of breath, and dyspnea. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death. Currently, there is no specific treatment for the disease caused by the novel coronavirus. Therefore,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/10C12N15/85C12N15/62G01N33/58G01N33/569
CPCC07K14/005C07K16/005C07K16/10C07K2317/24C07K2317/622C07K2319/02C07K2319/30C12N15/85C12N2770/20022C12N2800/107G01N33/56983G01N33/587G01N2333/165G01N2469/10
Inventor 杨正林串俊兰龚波石毅蒋黎黄璐琳龙腾镶刘东泽徐雨干盈盈
Owner SICHUAN MACCURA BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com