Isocitrate dehydrogenase kinase mutant and application thereof in preparation of aromatic amino acids

A technology for isocitric acid dehydrogenation and aromatic amino acids, applied in the field of biotechnology and molecular biology, to achieve the effect of clear genetic background and improved ability

Active Publication Date: 2020-06-16
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are few reports on improving the production of phenylalanine by modifying the activities of enzymes related to the central carbon metabolism TCA cycle.
At present, there is no report on the use of the mutant gene aceK encoding isocitrate dehydrogenase kinase in Escherichia coli for breeding strains with high aromatic amino acid production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isocitrate dehydrogenase kinase mutant and application thereof in preparation of aromatic amino acids
  • Isocitrate dehydrogenase kinase mutant and application thereof in preparation of aromatic amino acids
  • Isocitrate dehydrogenase kinase mutant and application thereof in preparation of aromatic amino acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1. Construction of pCas-aceK

[0019]The pCas-acek plasmid constructed in this example is used to replace the aceK wild-type gene on the genome of Escherichia coli tryptophan and phenylalanine engineering strains with the aceK mutant (E26K), and the specific working principle of the plasmid has been published ( Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C. Development of a fast and easy method for Escherichia coli genome editing with CRISPR / Cas9..2016Dec 1;15(1):205 .)'. The specific construction process of pCas-red is described as follows: the Cas9 protein (as a plasmid containing the Cas9 protein (Addgene number: 42876)) was synthesized into a gRNA protein (sequence: 5'-GT T TTAGAGCTAGA A ATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT) that does not contain the N20 sequence -3') and its promoter sequence (5'-CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3') and from pKD46 plasmid (Kirill A.Datsenko and Barry L.Wanner, One-step in...

Embodiment 2

[0027] Example 2. Construction of HDH5-k

[0028] The Escherichia coli phenylalanine engineered strain HDH5 was prepared to be competent, and the pCas-aceK plasmid was transferred into the competent cells, and spread on a plate containing ampicillin resistance for overnight culture at 30°. Pick a positive single colony and inoculate it into a test tube containing ampicillin LB liquid medium (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L), culture it under a shaker at 30°C for 6h, then add 2g / L Arabinose (induces the expression of Cas9 protein and recombinant protein on pKD46), promotes the selection of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named HDH5-k.

Embodiment 3

[0029] Example 3. Construction of Kw002-k

[0030] The Escherichia coli phenylalanine engineered strain Kw002 was prepared to be competent, and the pCas-aceK plasmid was transferred into the competent cells, and then spread on a plate containing ampicillin resistance and cultivated overnight at 30°. Pick a positive single colony and inoculate it into an LB test tube containing ampicillin, culture it under a shaker at 30°C for 6 hours, and then add 2 g / L of arabinose (to induce the expression of Cas9 protein and PKD46 recombinant protein) to promote the screening of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named Kw002-k.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an isocitrate dehydrogenase kinase mutant and application of the isocitrate dehydrogenase kinase mutant in preparation of aromatic amino acid. The sequence of an isocitrate dehydrogenase kinase mutant gene aceK is shown as SEQ ID No. 1. The constructed engineering bacterium containing the escherichia coli coded isocitrate dehydrogenase kinase mutant gene aceK is biologically safe and clear in genetic background, the capacity of escherichia coli for producing aromatic amino acid can be effectively improved, and the yield of phenylalanine and the yield of tryptophan are increased by 12.1% and 11.1% respectively.

Description

Technical field: [0001] The invention belongs to the fields of biotechnology and molecular biology, and in particular relates to an isocitrate dehydrogenase kinase mutant gene aceK encoded by Escherichia coli, an amino acid sequence encoded by the gene and application thereof. Background technique [0002] L-Phenylalanine (L-Phenylalanine), also known as L-phenyl-α-alanine, is a white crystalline powder with a bitter taste and a melting point of 283°C. It is widely found in eggs, milk and animal proteins in nature. , and its content is 5% to 6%, and it contains about 1% in vegetable protein. Phenylalanine is soluble in water, the solubility in water is 3%, hardly soluble in organic solvents such as ethanol, ether, etc., the solubility in 100°C water resistance is 51°C: 4.4g, and the isoelectric point is 5.48. Phenylalanine has racemic DL-form, L-form and D-form, the most important of which is L-phenylalanine. [0003] Phenylalanine is one of the eight essential amino acids...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N1/21C12P13/22C12R1/19
CPCC12N9/12C12N15/70C12P13/222C12P13/227C12Y207/11005
Inventor张大伟刘永飞
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI