Isocitrate lyase mutant and its application in the preparation of aromatic amino acids
A technology of isocitrate and lyase, applied in the field of biotechnology and molecular biology, to achieve the effect of clear genetic background and improve ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1. Construction of pCas-aceA
[0018]The pCas-aceA plasmid constructed in this example is used to replace the aceA wild-type gene on the genome of Escherichia coli tryptophan and phenylalanine engineering strains with the aceA mutant (G22S), and the specific working principle of the plasmid has been published ( Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C. Development of a fast and easy method for Escherichia coli genome editing with CRISPR / Cas9..2016Dec 1;15(1):205 .). The specific construction process of pCas-red is described as follows: the Cas9 protein (using the plasmid containing the Cas9 protein (Addgene number: 42876)) was synthesized into a gRNA protein (sequence: 5'-GT T TTAGAGCTAGA A ATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT- 3') and its promoter sequence (5'-CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3') and from the pKD46 plasmid (Kirill A. Datsenko and Barry L. Wanner, One-step inactivation of chromosomal genes...
Embodiment 2
[0026] Example 2. Construction of HDH5-a
[0027] The Escherichia coli phenylalanine engineered strain HDH5 was prepared to be competent, and the pCas-aceA plasmid was transferred into the competent cells, and spread on a plate containing ampicillin resistance for overnight culture at 30°. Pick a positive single colony and inoculate it into a test tube of LB liquid medium (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L) containing ampicillin, and then add 2g / L of ampicillin after culturing on a shaker at 30°C for 6h. Arabinose (inducing the expression of Cas9 protein and recombinant protein on pKD46), promotes the screening of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named HDH5-...
Embodiment 3
[0028] Example 3. Construction of Kw002-a
[0029] The Escherichia coli phenylalanine engineered strain Kw002 was prepared as a competent cell, and the pCas-aceA plasmid was transferred into the competent cell, and then spread on a plate containing ampicillin resistance and cultivated overnight at 30°. Pick a positive single colony and inoculate it into an LB test tube containing ampicillin, culture it under a shaker at 30°C for 6 hours, and then add 2 g / L of arabinose (to induce the expression of Cas9 protein and PKD46 recombinant protein) to promote the screening of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named Kw002-a.
PUM
Property | Measurement | Unit |
---|---|---|
specific rotation | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com