Unlock instant, AI-driven research and patent intelligence for your innovation.

Isocitrate lyase mutant and its application in the preparation of aromatic amino acids

A technology of isocitrate and lyase, applied in the field of biotechnology and molecular biology, to achieve the effect of clear genetic background and improve ability

Active Publication Date: 2021-10-22
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few reports on improving the production of phenylalanine by modifying the activities of enzymes related to the central carbon metabolism TCA cycle.
At present, there is no report on the use of the mutant gene aceA encoding isocitrate lyase in Escherichia coli to breed strains with high aromatic amino acid production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isocitrate lyase mutant and its application in the preparation of aromatic amino acids
  • Isocitrate lyase mutant and its application in the preparation of aromatic amino acids
  • Isocitrate lyase mutant and its application in the preparation of aromatic amino acids

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1. Construction of pCas-aceA

[0018]The pCas-aceA plasmid constructed in this example is used to replace the aceA wild-type gene on the genome of Escherichia coli tryptophan and phenylalanine engineering strains with the aceA mutant (G22S), and the specific working principle of the plasmid has been published ( Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C. Development of a fast and easy method for Escherichia coli genome editing with CRISPR / Cas9..2016Dec 1;15(1):205 .). The specific construction process of pCas-red is described as follows: the Cas9 protein (using the plasmid containing the Cas9 protein (Addgene number: 42876)) was synthesized into a gRNA protein (sequence: 5'-GT T TTAGAGCTAGA A ATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT- 3') and its promoter sequence (5'-CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3') and from the pKD46 plasmid (Kirill A. Datsenko and Barry L. Wanner, One-step inactivation of chromosomal genes...

Embodiment 2

[0026] Example 2. Construction of HDH5-a

[0027] The Escherichia coli phenylalanine engineered strain HDH5 was prepared to be competent, and the pCas-aceA plasmid was transferred into the competent cells, and spread on a plate containing ampicillin resistance for overnight culture at 30°. Pick a positive single colony and inoculate it into a test tube of LB liquid medium (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L) containing ampicillin, and then add 2g / L of ampicillin after culturing on a shaker at 30°C for 6h. Arabinose (inducing the expression of Cas9 protein and recombinant protein on pKD46), promotes the screening of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named HDH5-...

Embodiment 3

[0028] Example 3. Construction of Kw002-a

[0029] The Escherichia coli phenylalanine engineered strain Kw002 was prepared as a competent cell, and the pCas-aceA plasmid was transferred into the competent cell, and then spread on a plate containing ampicillin resistance and cultivated overnight at 30°. Pick a positive single colony and inoculate it into an LB test tube containing ampicillin, culture it under a shaker at 30°C for 6 hours, and then add 2 g / L of arabinose (to induce the expression of Cas9 protein and PKD46 recombinant protein) to promote the screening of Cas9 protein. Then continue to culture at 30°C for 6 hours on a shaker, put the bacterial solution on the LB plate containing ampicillin and 2g / L arabinose for three-section line, and culture overnight at constant temperature at 30°C. Colony PCR was used for verification and sequencing, and the strains with correct sequencing were named Kw002-a.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
specific rotationaaaaaaaaaa
Login to View More

Abstract

The invention discloses an isocitrate lyase mutant and its application in preparing aromatic amino acids. The sequence of the isocitrate lyase mutant gene aceA is shown in SEQ ID No. 1. The engineering bacterium constructed by the invention and containing the Escherichia coli encoding isocitrate lyase mutant gene aceA is biosafe and has a clear genetic background, and can effectively improve the ability of Escherichia coli to produce aromatic amino acids, phenylalanine and tryptophan. Yields increased by 11.2% and 13.7% respectively.

Description

Technical areas: [0001] The invention belongs to the fields of biotechnology and molecular biology, and specifically relates to an isocitrate lyase mutant gene aceA encoded by Escherichia coli and the amino acid sequence encoded by the gene and its application. Background technique [0002] Phenylalanine is an aromatic amino acid. It is one of the 20 amino acids that make up proteins and is an essential amino acid for the human body. L-phenylalanine is colorless to white flaky crystals or white crystalline powder at room temperature. It is soluble in water and insoluble in organic solvents such as ethanol. The specific optical rotation is -35.1° and the isoelectric point is 5.48. L-phenylalanine is one of the 8 essential amino acids. As a nutrient, it is also a glycogenic and ketogenic amino acid in the body and plays an irreplaceable role in metabolism. In industry, L-phenylalanine is mainly used to react with aspartic acid to form the artificial sweetener aspartame. This...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/88C12N15/60C12N1/21C12P13/22C12R1/19
CPCC12N9/88C12P13/222C12P13/227C12Y401/03001
Inventor 张大伟刘永飞
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI