Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof

A technology for myocardial infarction and cardiomyocytes, which is applied to the target DUSP6 and its application fields, can solve the problem of no effective treatment for reversing heart failure, and achieve the effects of reducing the risk of heart failure, improving cardiac function, and inhibiting the process of fibrosis.

Inactive Publication Date: 2020-07-24
PEKING UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no clinically effective treatment for heart failure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof
  • Target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof
  • Target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0126] Example 1, Construction and Verification of Dusp6 Mutant Rats

[0127] 1. Construction of Dusp6 mutant rats

[0128] According to the method in the literature "Xinli Hu, Nannan Chang, Xuelian Wang, et al.Heritable gene-targeting with gRNA / Cas9 in rats. Cell Research (2013) 23:1322-1325.", a series of Dusp6 were constructed using the CRISPR system Mutant rat strains.

[0129] The specific construction method is as follows: 1. Design guide RNA according to the corresponding sequence on exon 1 of Dusp6 gene, and the gRNA sequence is AGGACCGGGACCGCTTTACCAGG; 2. The above gRNA and Cas9 mRNA are synthesized by in vitro transcription; 3. The synthesized product is microinjected into large Mouse embryos (Cas9 mRNA concentration is 40ng / uL, gRNA concentration is 20ng / uL); 4. Transplant the injected embryos into surrogate mother mice; 5. Take out the postnatal neonatal mouse genome, and clone and sequence the corresponding mutation sites. The sequences of the sequencing primers...

Embodiment 2

[0135] Example 2. Cardiac function improvement after myocardial infarction in Dusp6 mutant rats

[0136] 1. Preparation of myocardial infarction model

[0137] The myocardial infarction models of wild-type rats and Dusp6 mutant rats were established by ligation of the anterior descending coronary artery. Specific steps are as follows:

[0138] 1. Rats (body weight 200-250g) were anesthetized by intraperitoneal injection of 10% chloral hydrate (0.3mL / 100g), fixed their limbs and head on the operating table in a supine position.

[0139]2. Perform endotracheal intubation, connect the ventilator, and adjust parameters according to body weight. After observing that the rat's chest rise and fall were completely consistent with the frequency of the ventilator, the surgical field was disinfected with alcohol, and the skin was cut at the most obvious part of the left chest heart beat. The pectoralis major and serratus anterior were bluntly separated, and the intercostal muscles wer...

Embodiment 3

[0157] Example 3, DUSP6 protein is highly expressed in neutrophils

[0158] 1. DUSP6 protein is highly expressed in neutrophils in myocardial infarction tissue

[0159] In order to further study the cellular mechanism of improved cardiac function after DUSP6 deletion-induced myocardial infarction, it is necessary to determine the cellular localization and expression distribution of DUSP6. Prepare the wild-type rat myocardial infarction model according to the method in Example 2, digest the myocardial tissue of the wild-type rat 72h after the myocardial infarction into a single cell suspension, and then use different cell marker antibodies (cell marker: anti-cTnT (Abcam, ab8295) labeled cardiomyocytes, anti-Rat CD31-FITC (Abd Serotec, MCA1334F) labeled vascular endothelial cells, anti-α-SMA-FITC (Abcam, ab184675) labeled vascular smooth muscle and fibroblasts, anti-RatCD45- PE-Cy7 (BD Biosciences, 561588) labeled all immune cells, in which neutrophils were co-labeled with anti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses a target DUSP6 related to myocardial infarction diagnosis and treatment and application thereof. The invention discloses application of a substance for inhibiting DUSP6 proteinactivity or a substance for inhibiting or silencing Dusp6 gene expression in any one of the following 1) to 11): 1) preparation of a product for treating myocardial infarction; 2) preparation of a product for improving cardiac function after myocardial infarction; 3) preparation of a product for inhibiting ventricular negative reconstruction after myocardial infarction; 4) preparation of a product for inhibiting expansion of infarction area after myocardial infarction; 5) preparation of a product for reducing the death number of myocardial cells in a non-infarction area after myocardial infarction; 6) preparation of a product for up-regulating phosphorylation level of neutrophil ERK; 7) preparation of a product for lowering phosphorylation level of neutrophil p38; 8) preparation of a product for lowering the superoxide release level of the neutrophils; 9) preparation of a product for lowering the degranulation level of the neutrophils; 10) preparation of a product for lowering the tissue killing activity of the neutrophils; and 11) preparation of a product for lowering the heart failure risk.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to target DUSP6 related to diagnosis and treatment of myocardial infarction and its application. Background technique [0002] Myocardial infarction is a disease with high morbidity and mortality, which has caused a significant economic and health burden to individuals, families and society. Current clinical treatment strategies include the following methods: (1) Onset stage: intravenous injection of morphine or pethidine to relieve angina symptoms and the feeling of dying; combined administration of nitrate drug β-blockers to increase coronary blood flow and Reduce myocardial oxygen consumption and improve symptoms of myocardial ischemia; take dual antiplatelet drugs (aspirin combined with ticagrelor) to prevent further thrombus formation. (2) Reperfusion therapy: Coronary angiography, stent implantation, coronary artery bypass grafting and other thrombolytic methods are us...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61P9/10A61P9/00
CPCA61K45/00A61P9/00A61P9/10
Inventor 熊敬维周小海朱小君
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com