Method for improving formation of citrobacter werkmanii biofilm
A technology of citrobacter and biofilm, applied in the field of genetic engineering, can solve the problems of limited biofilm formation ability and poor environmental adaptability of Citrobacter weimanii, and achieve the improvement of biofilm formation, drug resistance level and drug resistance , Broaden the effect of application scenarios and scope
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The following examples are to further illustrate the present invention, rather than limit the present invention.
[0020] The Citrobacter welkii used in the following examples is Citrobacter welmannii BF-6.
[0021] The primers used in the following examples are as follows:
[0022] ACGCCTGTCTCAAGCGGTTTTC(ompA-identify-F);
[0023] AAGAAGCATCGTGAGGGGGAAT(ompA-identify-R).
[0024] 1. Construction of ompA knockout vector
[0025] First, the upstream and downstream sequences (upstream 1005bp (corresponding to the 9th to 1013th bases of SEQ ID NO.2) of the ompA gene (its nucleotide sequence is shown in SEQ ID NO.1) and downstream 876bp (corresponding to the 1014th to 1889th bases of SEQ ID NO.2)) integrated together (without ompA gene itself sequence), then add BglII restriction site (GAAGATCT) at the front of the integrated sequence, followed by Add the SpeI restriction site (ACTAGTCC) and the protective base to the end, and entrust Shanghai Meiji Biomedical Technolog...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap