Virus recombinase-polymerase amplification detection method

A virus detection and virus technology, applied in the field of detection of new coronavirus, to achieve high sensitivity, speed up, and increase the effect of amplification multiple

Pending Publication Date: 2020-09-04
HANGZHOU ZIJING BIOLOGY CO LTD
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that the design of primers and probes of RPA is not as mature as that of traditional PCR, and requires a lot of exploration and testing to obtain ideal primers and probes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Virus recombinase-polymerase amplification detection method
  • Virus recombinase-polymerase amplification detection method
  • Virus recombinase-polymerase amplification detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Two-step RPA detection of COVID-19 virus RNA validity verification

[0061] 1. Reagent Preparation

[0062] COVID-19 virus RNA samples were purchased from national standard materials (standard material number: GBW(E)091099)

[0063] 1 st The RPA reaction kit was purchased from TwistDX Company in the UK, and the product model was Basic RT kit

[0064] 2 nd The RPA reaction kit was purchased from TwistDX Company in the UK, and the product model was nfo kit

[0065] Colloidal gold test paper was purchased from Beijing Kuer Technology Co., Ltd.

[0066] 2. Experimental steps

[0067] 1) The new coronavirus RNA stock solution (E gene RNA concentration: 1.06±0.11×10 3 copies / ul) diluted to 10copies / ul.

[0068] 2) Dilute the forward primer, reverse primer and probe to 10 uM with DEPC water. The primer sequences are as follows:

[0069] 1 st RPA-F: ATGTACTCATTCGTTTCGGAAGAGACAGG (SEQ ID No. 1)

[0070] 1 st RPA-R:AGACCAGAAGATCAGGAACTCTAGAAGAA (SEQ ...

Embodiment 2

[0093] Example 2 Two-step RPA detects free viral RNA sensitivity test

[0094] The reagent preparation, experimental steps, and two-step RPA reaction system of this embodiment are the same as those in Example 1.

[0095] 1. The experimental groups are as follows:

[0096] Experimental group 1: 1 st The RNA concentration used in the RPA reaction system was 15 copies / ul. Prepared 1 st After the RPA reaction system, mix evenly by inverting, briefly centrifuge, and react at 37°C for 10 minutes. Take 10ul1 st RPA reaction product was added to 2 nd In the RPA reaction system, mix by inverting, briefly centrifuge, and react at 37°C for 10 minutes.

[0097] Experimental group two: 1 st The RNA concentration used in the RPA reaction system was 8 copies / ul. Prepared 1 st After the RPA reaction system, mix evenly by inverting, briefly centrifuge, and react at 37°C for 10 minutes. Take 10ul1st RPA reaction product and add to 2 nd In the RPA reaction system, mix by invert...

Embodiment 3

[0104] Example 3 Two-step RPA limit reaction time test

[0105] The reagent preparation, experimental steps, and two-step RPA reaction system of this embodiment are the same as those in Example 1.

[0106] 1. The experimental groups are as follows:

[0107] Experimental group 1: According to the above table, prepare 1 st For the RPA reaction system, mix evenly by inversion, centrifuge briefly, and react at 37°C for 10 minutes. Take 10ul reaction product and add to 2 nd In the RPA reaction system, mix by inverting, briefly centrifuge, and react at 37°C for 10 minutes.

[0108] Experimental group 2: Prepare 1 according to the above table st For the RPA reaction system, mix evenly by inversion, centrifuge briefly, and react at 37°C for 10 minutes. Take 10ul reaction product and add to 2 nd In the RPA reaction system, mix by inverting, briefly centrifuge, and react at 37°C for 5 minutes.

[0109] Experimental group 3: according to the above table to prepare 1 st For t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rapid and high-sensitivity virus recombinase-polymerase amplification detection method, a primer group and a test kit. According to the detection method, nucleic acid of sudden virus such as COVID-19 can be rapidly detected with high sensitivity, nucleic acid does not need to be purified and extracted in the detection process, detection can be achieved after direct cracking, the nucleic acid testing operation steps are greatly simplified, the operation complexity is reduced. The method is suitable for rapid and instant detection of sudden sanitary events such as novel coronavirus.

Description

technical field [0001] The invention belongs to the field of virus detection, and in particular relates to a rapid and highly sensitive virus recombinase-polymerase amplification detection method, primer set and kit, especially for the detection of novel coronaviruses. Background technique [0002] The COVID-19 identification kit is mainly based on the fluorescent quantitative PCR method. Practice has shown that it has high detection specificity, low cost, and easy operation. However, this type of kit designs specific primers and probes based on known virus sequences, so it can only identify known virus types, but cannot identify unknown new viruses; Therefore, it is necessary to replace the primers and probes regularly and re-evaluate the actual situation. Moreover, according to the current clinical practice, it shows that there are many false negatives in the existing nucleic acid detection, which brings great harm to the prevention and control. The reason for the false n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844Y02A50/30
Inventor白净卫刘册李寅青严翔袁国华
OwnerHANGZHOU ZIJING BIOLOGY CO LTD