Efficient matching breeding method for procypris merus
A high-efficiency technology, applied in biochemical equipment and methods, recombinant DNA technology, and microbial assay/inspection, etc., can solve problems such as failure to reflect parental genetic differences and failure to improve the efficiency of breeding.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0014] Specific implementation mode one: the high-efficiency mating and breeding method of Hehua carp in this embodiment is carried out according to the following steps:
[0015] 1. Select broodstock groups of Hehua carp, implant electronic markers, and establish electronic files;
[0016] 2. Analyze the genotype and genetic composition of the broodstock population: a. collect parental blood or fin ray tissue, and extract genomic DNA; b. amplify genomic DNA with 20 QTLs of body weight and body length; c. use capillary coagulation Gel electrophoresis analysis of PCR products to obtain genotype data;
[0017] 3. Use genetic analysis software to calculate the genetic structure of the parent fish population and the genetic distance between individuals and draw a clustering tree, divide the breeding group, and then select the genetic distance between female and male individuals from the breeding group with a genetic distance of 0.8 to 1.0 and be able to enrich Parental individuals...
specific Embodiment approach 2
[0026] Specific embodiment two: the difference between this embodiment and specific embodiment one is: the extraction method of the genomic DNA sample of the broodstock population of the grass carp in step 2a is: adopt the genome DNA extraction kit to extract from the blood or fin rays of the grass carp Genomic DNA was extracted and purified from the tissue, and then the purity and concentration were measured with an ultraviolet spectrophotometer, and the genomic DNA was diluted to 50ng / μL. Other steps and parameters are the same as those in the first embodiment.
specific Embodiment approach 3
[0027] Specific embodiment three: the difference between this embodiment and specific embodiment one is: in step 2b, the QTLs of body weight and body length of 20 carps are located on 14 linkage groups of carp high-density genetic map, and the names and primer sequences are respectively for:
[0028] QTL HLJ3579
[0029] Upstream primer: GCAAATAGAAGGTAAATGAAATCG
[0030] Downstream primer: CGGAGCAGTGGGTGTGAT
[0031] QTL HLJ2424
[0032] Upstream primer: TTAGAACGGGAAGGCAAGG
[0033] Downstream primer: GCTTTTGTTTCACCCCTGGAT
[0034] QTL CAFS724
[0035] Upstream primer: TAAGGTTTGGGAGGACAGGT
[0036] Downstream primer: ATTCAAACCACCCTCACAAG
[0037] QTL HLJ2456
[0038] Upstream primer: CTCTCTACGCTTGGGCTGTA
[0039] Downstream primer: CATTTCCACACTATCCTTATCCA
[0040] QTL HLJ3460
[0041] Upstream primer: GAGTTTTTCTTACAGTCTTGTGTTGT
[0042] Downstream primer: TTACGCCATCCTCATCATCATCA
[0043] QTL CAFS2278
[0044] Upstream primer: TAGCCACACTTAAATAGACG
[0045] Downst...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


